ID: 1141791896

View in Genome Browser
Species Human (GRCh38)
Location 16:86242739-86242761
Sequence CACTCTCCCCTCTTCGTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141791890_1141791896 7 Left 1141791890 16:86242709-86242731 CCGCACCAGCGTGGAGGTGGCCT No data
Right 1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG No data
1141791888_1141791896 12 Left 1141791888 16:86242704-86242726 CCTGGCCGCACCAGCGTGGAGGT No data
Right 1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG No data
1141791885_1141791896 23 Left 1141791885 16:86242693-86242715 CCAGTAGGGTGCCTGGCCGCACC No data
Right 1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG No data
1141791891_1141791896 2 Left 1141791891 16:86242714-86242736 CCAGCGTGGAGGTGGCCTCCAGG No data
Right 1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141791896 Original CRISPR CACTCTCCCCTCTTCGTCGT GGG Intergenic
No off target data available for this crispr