ID: 1141797581

View in Genome Browser
Species Human (GRCh38)
Location 16:86285572-86285594
Sequence TGTCCACCCAGGAAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141797581_1141797586 -10 Left 1141797581 16:86285572-86285594 CCACCCACCTTCCTGGGTGGACA No data
Right 1141797586 16:86285585-86285607 TGGGTGGACACCCAGATGCTAGG No data
1141797581_1141797589 11 Left 1141797581 16:86285572-86285594 CCACCCACCTTCCTGGGTGGACA No data
Right 1141797589 16:86285606-86285628 GGCTCTGAGACCCCTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141797581 Original CRISPR TGTCCACCCAGGAAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr