ID: 1141797615

View in Genome Browser
Species Human (GRCh38)
Location 16:86285685-86285707
Sequence CACAGGTACCTGCCTCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141797615_1141797622 12 Left 1141797615 16:86285685-86285707 CCGGAGGGAGGCAGGTACCTGTG No data
Right 1141797622 16:86285720-86285742 GAGCCCCAGCGCACCATTTCAGG No data
1141797615_1141797620 -10 Left 1141797615 16:86285685-86285707 CCGGAGGGAGGCAGGTACCTGTG No data
Right 1141797620 16:86285698-86285720 GGTACCTGTGGGTAGAGCTGGGG No data
1141797615_1141797626 18 Left 1141797615 16:86285685-86285707 CCGGAGGGAGGCAGGTACCTGTG No data
Right 1141797626 16:86285726-86285748 CAGCGCACCATTTCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141797615 Original CRISPR CACAGGTACCTGCCTCCCTC CGG (reversed) Intergenic
No off target data available for this crispr