ID: 1141799595

View in Genome Browser
Species Human (GRCh38)
Location 16:86297875-86297897
Sequence CTCTGTCTGCAGAAGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141799591_1141799595 30 Left 1141799591 16:86297822-86297844 CCAGCAAGGACAGGGAAAGCAAC No data
Right 1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141799595 Original CRISPR CTCTGTCTGCAGAAGCAGAT TGG Intergenic
No off target data available for this crispr