ID: 1141801078

View in Genome Browser
Species Human (GRCh38)
Location 16:86309708-86309730
Sequence GTCACTTGGGTAGAAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141801078_1141801091 25 Left 1141801078 16:86309708-86309730 CCCTCACCTTCTACCCAAGTGAC No data
Right 1141801091 16:86309756-86309778 ACGGGCATGCATCTGCTAAGTGG No data
1141801078_1141801092 26 Left 1141801078 16:86309708-86309730 CCCTCACCTTCTACCCAAGTGAC No data
Right 1141801092 16:86309757-86309779 CGGGCATGCATCTGCTAAGTGGG No data
1141801078_1141801085 0 Left 1141801078 16:86309708-86309730 CCCTCACCTTCTACCCAAGTGAC No data
Right 1141801085 16:86309731-86309753 CTTGGCAAAGCCACTTGTCCTGG No data
1141801078_1141801087 6 Left 1141801078 16:86309708-86309730 CCCTCACCTTCTACCCAAGTGAC No data
Right 1141801087 16:86309737-86309759 AAAGCCACTTGTCCTGGGCACGG No data
1141801078_1141801088 7 Left 1141801078 16:86309708-86309730 CCCTCACCTTCTACCCAAGTGAC No data
Right 1141801088 16:86309738-86309760 AAGCCACTTGTCCTGGGCACGGG No data
1141801078_1141801086 1 Left 1141801078 16:86309708-86309730 CCCTCACCTTCTACCCAAGTGAC No data
Right 1141801086 16:86309732-86309754 TTGGCAAAGCCACTTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141801078 Original CRISPR GTCACTTGGGTAGAAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr