ID: 1141802302

View in Genome Browser
Species Human (GRCh38)
Location 16:86318333-86318355
Sequence CAGGAGACACAGTTGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141802302_1141802309 9 Left 1141802302 16:86318333-86318355 CCTATCTCCAACTGTGTCTCCTG No data
Right 1141802309 16:86318365-86318387 TATTTACTTCCTTCTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141802302 Original CRISPR CAGGAGACACAGTTGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr