ID: 1141802446

View in Genome Browser
Species Human (GRCh38)
Location 16:86320034-86320056
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141802446_1141802454 -10 Left 1141802446 16:86320034-86320056 CCCGCCCCCTCCCACCTTCGGCA No data
Right 1141802454 16:86320047-86320069 ACCTTCGGCATGTGAGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141802446 Original CRISPR TGCCGAAGGTGGGAGGGGGC GGG (reversed) Intergenic
No off target data available for this crispr