ID: 1141805631

View in Genome Browser
Species Human (GRCh38)
Location 16:86339585-86339607
Sequence CTTTGCTGCAACACGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141805631_1141805635 1 Left 1141805631 16:86339585-86339607 CCTGCACCCGTGTTGCAGCAAAG No data
Right 1141805635 16:86339609-86339631 ACATGATCTCATTCTTGTTATGG No data
1141805631_1141805636 4 Left 1141805631 16:86339585-86339607 CCTGCACCCGTGTTGCAGCAAAG No data
Right 1141805636 16:86339612-86339634 TGATCTCATTCTTGTTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141805631 Original CRISPR CTTTGCTGCAACACGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr