ID: 1141805833

View in Genome Browser
Species Human (GRCh38)
Location 16:86340890-86340912
Sequence GGCTCCCCTGCGCCCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141805833_1141805840 10 Left 1141805833 16:86340890-86340912 CCACCAGGGGGCGCAGGGGAGCC No data
Right 1141805840 16:86340923-86340945 ACCTGCAGAGTGCACAGGTTGGG No data
1141805833_1141805842 11 Left 1141805833 16:86340890-86340912 CCACCAGGGGGCGCAGGGGAGCC No data
Right 1141805842 16:86340924-86340946 CCTGCAGAGTGCACAGGTTGGGG No data
1141805833_1141805843 12 Left 1141805833 16:86340890-86340912 CCACCAGGGGGCGCAGGGGAGCC No data
Right 1141805843 16:86340925-86340947 CTGCAGAGTGCACAGGTTGGGGG No data
1141805833_1141805838 5 Left 1141805833 16:86340890-86340912 CCACCAGGGGGCGCAGGGGAGCC No data
Right 1141805838 16:86340918-86340940 TCAGCACCTGCAGAGTGCACAGG No data
1141805833_1141805839 9 Left 1141805833 16:86340890-86340912 CCACCAGGGGGCGCAGGGGAGCC No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141805833 Original CRISPR GGCTCCCCTGCGCCCCCTGG TGG (reversed) Intergenic
No off target data available for this crispr