ID: 1141805839

View in Genome Browser
Species Human (GRCh38)
Location 16:86340922-86340944
Sequence CACCTGCAGAGTGCACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141805826_1141805839 21 Left 1141805826 16:86340878-86340900 CCCTCGTCCTCACCACCAGGGGG No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data
1141805830_1141805839 14 Left 1141805830 16:86340885-86340907 CCTCACCACCAGGGGGCGCAGGG No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data
1141805828_1141805839 20 Left 1141805828 16:86340879-86340901 CCTCGTCCTCACCACCAGGGGGC No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data
1141805833_1141805839 9 Left 1141805833 16:86340890-86340912 CCACCAGGGGGCGCAGGGGAGCC No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data
1141805824_1141805839 22 Left 1141805824 16:86340877-86340899 CCCCTCGTCCTCACCACCAGGGG No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data
1141805834_1141805839 6 Left 1141805834 16:86340893-86340915 CCAGGGGGCGCAGGGGAGCCCCA No data
Right 1141805839 16:86340922-86340944 CACCTGCAGAGTGCACAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141805839 Original CRISPR CACCTGCAGAGTGCACAGGT TGG Intergenic
No off target data available for this crispr