ID: 1141806901

View in Genome Browser
Species Human (GRCh38)
Location 16:86347814-86347836
Sequence CTCGCTTTCCCCACTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141806891_1141806901 11 Left 1141806891 16:86347780-86347802 CCCCACCCCAAAGGGGCTTGAGC No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806892_1141806901 10 Left 1141806892 16:86347781-86347803 CCCACCCCAAAGGGGCTTGAGCA No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806896_1141806901 4 Left 1141806896 16:86347787-86347809 CCAAAGGGGCTTGAGCATGTTCC No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806894_1141806901 6 Left 1141806894 16:86347785-86347807 CCCCAAAGGGGCTTGAGCATGTT No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806895_1141806901 5 Left 1141806895 16:86347786-86347808 CCCAAAGGGGCTTGAGCATGTTC No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806887_1141806901 17 Left 1141806887 16:86347774-86347796 CCCACCCCCCACCCCAAAGGGGC No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806889_1141806901 13 Left 1141806889 16:86347778-86347800 CCCCCCACCCCAAAGGGGCTTGA No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806893_1141806901 9 Left 1141806893 16:86347782-86347804 CCACCCCAAAGGGGCTTGAGCAT No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806888_1141806901 16 Left 1141806888 16:86347775-86347797 CCACCCCCCACCCCAAAGGGGCT No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806890_1141806901 12 Left 1141806890 16:86347779-86347801 CCCCCACCCCAAAGGGGCTTGAG No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data
1141806883_1141806901 24 Left 1141806883 16:86347767-86347789 CCATCTTCCCACCCCCCACCCCA No data
Right 1141806901 16:86347814-86347836 CTCGCTTTCCCCACTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141806901 Original CRISPR CTCGCTTTCCCCACTGAAGG AGG Intergenic
No off target data available for this crispr