ID: 1141810175

View in Genome Browser
Species Human (GRCh38)
Location 16:86370888-86370910
Sequence TACAGAAAGTGCGACACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141810175_1141810177 -5 Left 1141810175 16:86370888-86370910 CCTGTGGTGTCGCACTTTCTGTA No data
Right 1141810177 16:86370906-86370928 CTGTAACATAATGGAGCAAACGG No data
1141810175_1141810178 -4 Left 1141810175 16:86370888-86370910 CCTGTGGTGTCGCACTTTCTGTA No data
Right 1141810178 16:86370907-86370929 TGTAACATAATGGAGCAAACGGG No data
1141810175_1141810180 21 Left 1141810175 16:86370888-86370910 CCTGTGGTGTCGCACTTTCTGTA No data
Right 1141810180 16:86370932-86370954 AATTCCAAGAATTGTGCGCTGGG No data
1141810175_1141810179 20 Left 1141810175 16:86370888-86370910 CCTGTGGTGTCGCACTTTCTGTA No data
Right 1141810179 16:86370931-86370953 CAATTCCAAGAATTGTGCGCTGG No data
1141810175_1141810182 30 Left 1141810175 16:86370888-86370910 CCTGTGGTGTCGCACTTTCTGTA No data
Right 1141810182 16:86370941-86370963 AATTGTGCGCTGGGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141810175 Original CRISPR TACAGAAAGTGCGACACCAC AGG (reversed) Intergenic
No off target data available for this crispr