ID: 1141811517

View in Genome Browser
Species Human (GRCh38)
Location 16:86379275-86379297
Sequence CCCTTGGTGGGCTGCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141811517_1141811530 27 Left 1141811517 16:86379275-86379297 CCAGGGAAGCAGCCCACCAAGGG No data
Right 1141811530 16:86379325-86379347 CCCAGGGCTCCAGTGCCGCCAGG No data
1141811517_1141811525 11 Left 1141811517 16:86379275-86379297 CCAGGGAAGCAGCCCACCAAGGG No data
Right 1141811525 16:86379309-86379331 GAAGTTGCAGCCCATCCCCAGGG No data
1141811517_1141811524 10 Left 1141811517 16:86379275-86379297 CCAGGGAAGCAGCCCACCAAGGG No data
Right 1141811524 16:86379308-86379330 CGAAGTTGCAGCCCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141811517 Original CRISPR CCCTTGGTGGGCTGCTTCCC TGG (reversed) Intergenic
No off target data available for this crispr