ID: 1141817812

View in Genome Browser
Species Human (GRCh38)
Location 16:86424968-86424990
Sequence GGCCCTTTCGCTCCCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141817812_1141817815 1 Left 1141817812 16:86424968-86424990 CCTGCAATGGGAGCGAAAGGGCC No data
Right 1141817815 16:86424992-86425014 AGCTTCCTGTCTCAGTGGACAGG No data
1141817812_1141817819 20 Left 1141817812 16:86424968-86424990 CCTGCAATGGGAGCGAAAGGGCC No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data
1141817812_1141817817 16 Left 1141817812 16:86424968-86424990 CCTGCAATGGGAGCGAAAGGGCC No data
Right 1141817817 16:86425007-86425029 TGGACAGGATGAACAGCAGCAGG No data
1141817812_1141817818 19 Left 1141817812 16:86424968-86424990 CCTGCAATGGGAGCGAAAGGGCC No data
Right 1141817818 16:86425010-86425032 ACAGGATGAACAGCAGCAGGAGG No data
1141817812_1141817813 -4 Left 1141817812 16:86424968-86424990 CCTGCAATGGGAGCGAAAGGGCC No data
Right 1141817813 16:86424987-86425009 GGCCGAGCTTCCTGTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141817812 Original CRISPR GGCCCTTTCGCTCCCATTGC AGG (reversed) Intergenic
No off target data available for this crispr