ID: 1141817816

View in Genome Browser
Species Human (GRCh38)
Location 16:86424997-86425019
Sequence TTCATCCTGTCCACTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141817816_1141817819 -9 Left 1141817816 16:86424997-86425019 CCTGTCTCAGTGGACAGGATGAA No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data
1141817816_1141817820 7 Left 1141817816 16:86424997-86425019 CCTGTCTCAGTGGACAGGATGAA No data
Right 1141817820 16:86425027-86425049 AGGAGGGTGCATTCAGCCCCAGG No data
1141817816_1141817818 -10 Left 1141817816 16:86424997-86425019 CCTGTCTCAGTGGACAGGATGAA No data
Right 1141817818 16:86425010-86425032 ACAGGATGAACAGCAGCAGGAGG No data
1141817816_1141817821 8 Left 1141817816 16:86424997-86425019 CCTGTCTCAGTGGACAGGATGAA No data
Right 1141817821 16:86425028-86425050 GGAGGGTGCATTCAGCCCCAGGG No data
1141817816_1141817824 24 Left 1141817816 16:86424997-86425019 CCTGTCTCAGTGGACAGGATGAA No data
Right 1141817824 16:86425044-86425066 CCCAGGGTAGAGAAGACCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141817816 Original CRISPR TTCATCCTGTCCACTGAGAC AGG (reversed) Intergenic
No off target data available for this crispr