ID: 1141817819

View in Genome Browser
Species Human (GRCh38)
Location 16:86425011-86425033
Sequence CAGGATGAACAGCAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141817812_1141817819 20 Left 1141817812 16:86424968-86424990 CCTGCAATGGGAGCGAAAGGGCC No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data
1141817814_1141817819 -1 Left 1141817814 16:86424989-86425011 CCGAGCTTCCTGTCTCAGTGGAC No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data
1141817808_1141817819 28 Left 1141817808 16:86424960-86424982 CCCACATTCCTGCAATGGGAGCG No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data
1141817809_1141817819 27 Left 1141817809 16:86424961-86424983 CCACATTCCTGCAATGGGAGCGA No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data
1141817816_1141817819 -9 Left 1141817816 16:86424997-86425019 CCTGTCTCAGTGGACAGGATGAA No data
Right 1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141817819 Original CRISPR CAGGATGAACAGCAGCAGGA GGG Intergenic
No off target data available for this crispr