ID: 1141817925

View in Genome Browser
Species Human (GRCh38)
Location 16:86425503-86425525
Sequence CACTGCCCTGGAGGTGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141817925_1141817933 13 Left 1141817925 16:86425503-86425525 CCCAGGACACCTCCAGGGCAGTG No data
Right 1141817933 16:86425539-86425561 GCCACAGGACACAGTCATCTGGG No data
1141817925_1141817930 -2 Left 1141817925 16:86425503-86425525 CCCAGGACACCTCCAGGGCAGTG No data
Right 1141817930 16:86425524-86425546 TGAGCAGGCCAGTCTGCCACAGG No data
1141817925_1141817932 12 Left 1141817925 16:86425503-86425525 CCCAGGACACCTCCAGGGCAGTG No data
Right 1141817932 16:86425538-86425560 TGCCACAGGACACAGTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141817925 Original CRISPR CACTGCCCTGGAGGTGTCCT GGG (reversed) Intergenic
No off target data available for this crispr