ID: 1141818772

View in Genome Browser
Species Human (GRCh38)
Location 16:86431043-86431065
Sequence TCAGTATCACAGAGGGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818772_1141818779 -4 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818779 16:86431062-86431084 CTGAGCAGGGGCAGCAGTCAGGG No data
1141818772_1141818784 25 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818784 16:86431091-86431113 AAGGAAAGAGGCAGCACCCTTGG No data
1141818772_1141818782 13 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818782 16:86431079-86431101 TCAGGGTCCTGGAAGGAAAGAGG No data
1141818772_1141818781 6 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818781 16:86431072-86431094 GCAGCAGTCAGGGTCCTGGAAGG No data
1141818772_1141818785 29 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818785 16:86431095-86431117 AAAGAGGCAGCACCCTTGGCTGG No data
1141818772_1141818778 -5 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818778 16:86431061-86431083 ACTGAGCAGGGGCAGCAGTCAGG No data
1141818772_1141818780 2 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818780 16:86431068-86431090 AGGGGCAGCAGTCAGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818772 Original CRISPR TCAGTATCACAGAGGGCTCT TGG (reversed) Intergenic
No off target data available for this crispr