ID: 1141818777

View in Genome Browser
Species Human (GRCh38)
Location 16:86431051-86431073
Sequence GCCCCTGCTCAGTATCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818777_1141818785 21 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818785 16:86431095-86431117 AAAGAGGCAGCACCCTTGGCTGG No data
1141818777_1141818781 -2 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818781 16:86431072-86431094 GCAGCAGTCAGGGTCCTGGAAGG No data
1141818777_1141818786 29 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818786 16:86431103-86431125 AGCACCCTTGGCTGGCGATCTGG No data
1141818777_1141818782 5 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818782 16:86431079-86431101 TCAGGGTCCTGGAAGGAAAGAGG No data
1141818777_1141818780 -6 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818780 16:86431068-86431090 AGGGGCAGCAGTCAGGGTCCTGG No data
1141818777_1141818784 17 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818784 16:86431091-86431113 AAGGAAAGAGGCAGCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818777 Original CRISPR GCCCCTGCTCAGTATCACAG AGG (reversed) Intergenic
No off target data available for this crispr