ID: 1141818778

View in Genome Browser
Species Human (GRCh38)
Location 16:86431061-86431083
Sequence ACTGAGCAGGGGCAGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818772_1141818778 -5 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818778 16:86431061-86431083 ACTGAGCAGGGGCAGCAGTCAGG No data
1141818771_1141818778 -1 Left 1141818771 16:86431039-86431061 CCAACCAAGAGCCCTCTGTGATA No data
Right 1141818778 16:86431061-86431083 ACTGAGCAGGGGCAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818778 Original CRISPR ACTGAGCAGGGGCAGCAGTC AGG Intergenic
No off target data available for this crispr