ID: 1141818784

View in Genome Browser
Species Human (GRCh38)
Location 16:86431091-86431113
Sequence AAGGAAAGAGGCAGCACCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818771_1141818784 29 Left 1141818771 16:86431039-86431061 CCAACCAAGAGCCCTCTGTGATA No data
Right 1141818784 16:86431091-86431113 AAGGAAAGAGGCAGCACCCTTGG No data
1141818772_1141818784 25 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818784 16:86431091-86431113 AAGGAAAGAGGCAGCACCCTTGG No data
1141818775_1141818784 18 Left 1141818775 16:86431050-86431072 CCCTCTGTGATACTGAGCAGGGG No data
Right 1141818784 16:86431091-86431113 AAGGAAAGAGGCAGCACCCTTGG No data
1141818777_1141818784 17 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818784 16:86431091-86431113 AAGGAAAGAGGCAGCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818784 Original CRISPR AAGGAAAGAGGCAGCACCCT TGG Intergenic
No off target data available for this crispr