ID: 1141818785

View in Genome Browser
Species Human (GRCh38)
Location 16:86431095-86431117
Sequence AAAGAGGCAGCACCCTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818772_1141818785 29 Left 1141818772 16:86431043-86431065 CCAAGAGCCCTCTGTGATACTGA No data
Right 1141818785 16:86431095-86431117 AAAGAGGCAGCACCCTTGGCTGG No data
1141818777_1141818785 21 Left 1141818777 16:86431051-86431073 CCTCTGTGATACTGAGCAGGGGC No data
Right 1141818785 16:86431095-86431117 AAAGAGGCAGCACCCTTGGCTGG No data
1141818775_1141818785 22 Left 1141818775 16:86431050-86431072 CCCTCTGTGATACTGAGCAGGGG No data
Right 1141818785 16:86431095-86431117 AAAGAGGCAGCACCCTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818785 Original CRISPR AAAGAGGCAGCACCCTTGGC TGG Intergenic
No off target data available for this crispr