ID: 1141818892

View in Genome Browser
Species Human (GRCh38)
Location 16:86431698-86431720
Sequence ACCTCCAAGGCTGTTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818892_1141818907 27 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG No data
1141818892_1141818900 1 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818900 16:86431722-86431744 GGCTGACGGGATGCAGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 187
1141818892_1141818902 6 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 176
1141818892_1141818901 2 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818901 16:86431723-86431745 GCTGACGGGATGCAGCCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1141818892_1141818899 0 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818899 16:86431721-86431743 GGGCTGACGGGATGCAGCCCCGG 0: 1
1: 0
2: 1
3: 16
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818892 Original CRISPR ACCTCCAAGGCTGTTCAGCA GGG (reversed) Intergenic