ID: 1141818893

View in Genome Browser
Species Human (GRCh38)
Location 16:86431699-86431721
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818893_1141818900 0 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818900 16:86431722-86431744 GGCTGACGGGATGCAGCCCCGGG No data
1141818893_1141818902 5 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG No data
1141818893_1141818907 26 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG No data
1141818893_1141818901 1 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818901 16:86431723-86431745 GCTGACGGGATGCAGCCCCGGGG No data
1141818893_1141818899 -1 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818899 16:86431721-86431743 GGGCTGACGGGATGCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818893 Original CRISPR CACCTCCAAGGCTGTTCAGC AGG (reversed) Intergenic