ID: 1141818898 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:86431711-86431733 |
| Sequence | ATCCCGTCAGCCCACCTCCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141818898_1141818902 | -7 | Left | 1141818898 | 16:86431711-86431733 | CCTTGGAGGTGGGCTGACGGGAT | No data | ||
| Right | 1141818902 | 16:86431727-86431749 | ACGGGATGCAGCCCCGGGGCCGG | 0: 1 1: 0 2: 1 3: 8 4: 176 |
||||
| 1141818898_1141818907 | 14 | Left | 1141818898 | 16:86431711-86431733 | CCTTGGAGGTGGGCTGACGGGAT | No data | ||
| Right | 1141818907 | 16:86431748-86431770 | GGTCTGACTCAGCACCAGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141818898 | Original CRISPR | ATCCCGTCAGCCCACCTCCA AGG (reversed) | Intergenic | ||