ID: 1141818898

View in Genome Browser
Species Human (GRCh38)
Location 16:86431711-86431733
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818898_1141818907 14 Left 1141818898 16:86431711-86431733 CCTTGGAGGTGGGCTGACGGGAT No data
Right 1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG No data
1141818898_1141818902 -7 Left 1141818898 16:86431711-86431733 CCTTGGAGGTGGGCTGACGGGAT No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818898 Original CRISPR ATCCCGTCAGCCCACCTCCA AGG (reversed) Intergenic