ID: 1141818899

View in Genome Browser
Species Human (GRCh38)
Location 16:86431721-86431743
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818886_1141818899 30 Left 1141818886 16:86431668-86431690 CCACGCGACCTCATTGAATCTTG No data
Right 1141818899 16:86431721-86431743 GGGCTGACGGGATGCAGCCCCGG No data
1141818889_1141818899 22 Left 1141818889 16:86431676-86431698 CCTCATTGAATCTTGACGGTGGC No data
Right 1141818899 16:86431721-86431743 GGGCTGACGGGATGCAGCCCCGG No data
1141818893_1141818899 -1 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818899 16:86431721-86431743 GGGCTGACGGGATGCAGCCCCGG No data
1141818892_1141818899 0 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818899 16:86431721-86431743 GGGCTGACGGGATGCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818899 Original CRISPR GGGCTGACGGGATGCAGCCC CGG Intergenic