ID: 1141818900

View in Genome Browser
Species Human (GRCh38)
Location 16:86431722-86431744
Sequence GGCTGACGGGATGCAGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818892_1141818900 1 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818900 16:86431722-86431744 GGCTGACGGGATGCAGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 187
1141818893_1141818900 0 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818900 16:86431722-86431744 GGCTGACGGGATGCAGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 187
1141818889_1141818900 23 Left 1141818889 16:86431676-86431698 CCTCATTGAATCTTGACGGTGGC No data
Right 1141818900 16:86431722-86431744 GGCTGACGGGATGCAGCCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818900 Original CRISPR GGCTGACGGGATGCAGCCCC GGG Intergenic