ID: 1141818901

View in Genome Browser
Species Human (GRCh38)
Location 16:86431723-86431745
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818893_1141818901 1 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818901 16:86431723-86431745 GCTGACGGGATGCAGCCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1141818889_1141818901 24 Left 1141818889 16:86431676-86431698 CCTCATTGAATCTTGACGGTGGC No data
Right 1141818901 16:86431723-86431745 GCTGACGGGATGCAGCCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 114
1141818892_1141818901 2 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818901 16:86431723-86431745 GCTGACGGGATGCAGCCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818901 Original CRISPR GCTGACGGGATGCAGCCCCG GGG Intergenic