ID: 1141818902

View in Genome Browser
Species Human (GRCh38)
Location 16:86431727-86431749
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818889_1141818902 28 Left 1141818889 16:86431676-86431698 CCTCATTGAATCTTGACGGTGGC No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 176
1141818892_1141818902 6 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 176
1141818898_1141818902 -7 Left 1141818898 16:86431711-86431733 CCTTGGAGGTGGGCTGACGGGAT No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 176
1141818893_1141818902 5 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818902 16:86431727-86431749 ACGGGATGCAGCCCCGGGGCCGG 0: 1
1: 0
2: 1
3: 8
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818902 Original CRISPR ACGGGATGCAGCCCCGGGGC CGG Intergenic