ID: 1141818907 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:86431748-86431770 |
| Sequence | GGTCTGACTCAGCACCAGAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141818893_1141818907 | 26 | Left | 1141818893 | 16:86431699-86431721 | CCTGCTGAACAGCCTTGGAGGTG | No data | ||
| Right | 1141818907 | 16:86431748-86431770 | GGTCTGACTCAGCACCAGAGTGG | No data | ||||
| 1141818898_1141818907 | 14 | Left | 1141818898 | 16:86431711-86431733 | CCTTGGAGGTGGGCTGACGGGAT | No data | ||
| Right | 1141818907 | 16:86431748-86431770 | GGTCTGACTCAGCACCAGAGTGG | No data | ||||
| 1141818892_1141818907 | 27 | Left | 1141818892 | 16:86431698-86431720 | CCCTGCTGAACAGCCTTGGAGGT | No data | ||
| Right | 1141818907 | 16:86431748-86431770 | GGTCTGACTCAGCACCAGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141818907 | Original CRISPR | GGTCTGACTCAGCACCAGAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||