ID: 1141818907

View in Genome Browser
Species Human (GRCh38)
Location 16:86431748-86431770
Sequence GGTCTGACTCAGCACCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141818892_1141818907 27 Left 1141818892 16:86431698-86431720 CCCTGCTGAACAGCCTTGGAGGT No data
Right 1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG No data
1141818898_1141818907 14 Left 1141818898 16:86431711-86431733 CCTTGGAGGTGGGCTGACGGGAT No data
Right 1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG No data
1141818893_1141818907 26 Left 1141818893 16:86431699-86431721 CCTGCTGAACAGCCTTGGAGGTG No data
Right 1141818907 16:86431748-86431770 GGTCTGACTCAGCACCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141818907 Original CRISPR GGTCTGACTCAGCACCAGAG TGG Intergenic