ID: 1141819475

View in Genome Browser
Species Human (GRCh38)
Location 16:86434999-86435021
Sequence AAAGCTCTGCATAGTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141819475_1141819478 1 Left 1141819475 16:86434999-86435021 CCACCTGGACTATGCAGAGCTTT 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1141819478 16:86435023-86435045 ACAACAGGCTGCACTCAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 351
1141819475_1141819479 2 Left 1141819475 16:86434999-86435021 CCACCTGGACTATGCAGAGCTTT 0: 1
1: 0
2: 1
3: 10
4: 133
Right 1141819479 16:86435024-86435046 CAACAGGCTGCACTCAACCAGGG 0: 1
1: 0
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141819475 Original CRISPR AAAGCTCTGCATAGTCCAGG TGG (reversed) Intergenic
905034037 1:34905394-34905416 AAGGCTCTTCATAGTCTTGGGGG + Exonic
907198923 1:52709412-52709434 AAGGCTCTGCATTGTCCACATGG - Intergenic
907359926 1:53906255-53906277 GAGGCTCTACATAATCCAGGAGG + Exonic
907845630 1:58203812-58203834 AAAGCTCTACATAGTCAACTGGG - Intronic
911578980 1:99613229-99613251 AGAGCTCTGAAGAGTCCAAGGGG - Intergenic
912548012 1:110465299-110465321 AAGGCTTTCCAGAGTCCAGGTGG - Intergenic
915554865 1:156655809-156655831 ACAGTTCTGTATAGTCCAGGTGG - Intronic
915934199 1:160081359-160081381 CAAGCTCTGAGTTGTCCAGGAGG + Intergenic
917637935 1:176955214-176955236 AATGCTCTGCAAACTGCAGGTGG + Intronic
917957404 1:180114549-180114571 AAGGCTTTGCAAAGTCCAGAAGG - Exonic
919540397 1:198838196-198838218 AAAGACCTGCAAAGTCCAGAAGG + Intergenic
921380293 1:214517675-214517697 AAAGCTTTGTATAGTCTAGAGGG - Intronic
921953091 1:220954135-220954157 AAAGACCAGCATATTCCAGGGGG + Intergenic
922152280 1:223016782-223016804 AAAGCTCTGCTTACTACACGAGG - Intergenic
924192264 1:241566302-241566324 AAAGCTCTGCAAAGTCCCAGGGG - Intronic
1063493560 10:6486792-6486814 GAAGCTCTTCATGGCCCAGGTGG - Intronic
1064177381 10:13086808-13086830 AAAGCTGTGGTTGGTCCAGGGGG + Intronic
1064582716 10:16810472-16810494 AGAGCTGTGCATAGCCCGGGGGG - Intronic
1066278508 10:33891720-33891742 AAAGCCCTGAAGAGTCCGGGGGG + Intergenic
1067107705 10:43376810-43376832 GAAGCCCTGCATAGTGCATGTGG + Intergenic
1067293852 10:44963149-44963171 AAGACTCTGCACTGTCCAGGTGG - Intronic
1067320753 10:45218616-45218638 AGAGCTGTGGATAGCCCAGGGGG - Intergenic
1068842717 10:61633250-61633272 ACATCTCTGCAGAGCCCAGGAGG + Intergenic
1071392496 10:85189905-85189927 AAACCTGTGCTTAGTCCAGAGGG + Intergenic
1073150063 10:101305427-101305449 ACAGCTCTGCACAGTCCGTGTGG - Intergenic
1074016050 10:109535264-109535286 AAAGAGCTGCAGAGTCCAAGAGG - Intergenic
1074596441 10:114872160-114872182 AGATCTCAGCATGGTCCAGGGGG - Intronic
1076137221 10:128053506-128053528 AAAGGGCTGCAGAGTCCATGTGG + Intronic
1080964065 11:37194247-37194269 AAAAATCTGCATTGTCCATGAGG + Intergenic
1083542658 11:63524361-63524383 AAAGCTCTCCATAGTGAAGAGGG + Intergenic
1084313970 11:68332911-68332933 AAAGCTCTGCAAACTCAAGCTGG - Intronic
1085351935 11:75803217-75803239 TAAGCTGTGCATAGGGCAGGGGG + Intergenic
1086345546 11:85892104-85892126 AAAGCTCTCAACAGGCCAGGAGG + Intronic
1087741084 11:101887923-101887945 ACAGATCTGAATAGTCCGGGAGG + Intergenic
1093262046 12:16950526-16950548 AAAGGTCAGTAGAGTCCAGGAGG + Intergenic
1093750765 12:22797118-22797140 AAAGCTTAGCACAGTCCAGAAGG + Intergenic
1093791158 12:23251795-23251817 AAGGCTCTTTATATTCCAGGAGG + Intergenic
1095698189 12:45164357-45164379 ACAGCTCTGGAGAGTCCATGGGG + Intergenic
1097019747 12:56011887-56011909 AAAGCTTTGCATAATTGAGGAGG - Intronic
1097942494 12:65326981-65327003 AAAGCACTGCAGAGGGCAGGGGG - Intronic
1103420497 12:120777933-120777955 AAAGGTCTGTATAGTCTAGAGGG + Intronic
1103434566 12:120914946-120914968 AAAGCTACACATAGTACAGGTGG + Intergenic
1104959027 12:132479460-132479482 GGAGCCCTGCATGGTCCAGGCGG - Intergenic
1110828320 13:79999272-79999294 AAAGATTTGCATATTCCAGGAGG - Intergenic
1113149331 13:107243991-107244013 AAATTTCTGCAGAGTCCAGGAGG - Intronic
1113987106 13:114326481-114326503 AAATTTCTGTATAGTCCAGATGG + Exonic
1115239134 14:31237333-31237355 AAAACTCACCATAATCCAGGTGG - Intergenic
1116957610 14:50941043-50941065 AAAGCACTTCTCAGTCCAGGTGG - Intronic
1121487715 14:94331346-94331368 AAGGCTGTGGATAGTACAGGTGG - Intergenic
1121626169 14:95386816-95386838 AAAGTCCTGCTCAGTCCAGGAGG - Intergenic
1122982425 14:105197652-105197674 ACAGTCCTGCAGAGTCCAGGGGG - Intergenic
1123129040 14:105971062-105971084 AAATCGCTGCATAATGCAGGAGG + Intergenic
1123409558 15:20047227-20047249 AAATCTCTGCATAATGCAGGAGG + Intergenic
1123518888 15:21053935-21053957 AAATCTCTGCATAATGCAGGAGG + Intergenic
1124154931 15:27217545-27217567 AAAGCTCTGCCCAGCCCAGCAGG + Intronic
1126782266 15:52148970-52148992 ACACCCCTGCATAGTCCAGAAGG + Intronic
1131082908 15:89551887-89551909 AAATGTCTGAATAGTCCAGCGGG + Intergenic
1132927208 16:2437052-2437074 AAAGCTCTCCATGGTCTTGGTGG - Intronic
1134604450 16:15559318-15559340 AGAGCTCTGATTTGTCCAGGAGG - Intronic
1135117441 16:19735648-19735670 AAAGCTCTCCGGAGTCCAAGTGG - Intronic
1135915913 16:26605316-26605338 AATGCCCTGCATAGTGGAGGGGG - Intergenic
1139009608 16:62616211-62616233 AAAGCTCTGGGTACTCAAGGAGG - Intergenic
1140694106 16:77514817-77514839 AAAGTTCTGCATATTTCAGCAGG - Intergenic
1141092026 16:81136977-81136999 AAAGCTCTGCAAACTACAGCTGG - Intergenic
1141819475 16:86434999-86435021 AAAGCTCTGCATAGTCCAGGTGG - Intergenic
1142696323 17:1635680-1635702 ACAGCTCAGCATCTTCCAGGAGG + Intronic
1144762348 17:17714454-17714476 AAACCTCTCCATAGGCCAGGAGG + Intronic
1145126199 17:20302064-20302086 AACTCTCTGCTTAGTCCAGACGG + Intronic
1151399143 17:73844098-73844120 AATGGTTTGCATGGTCCAGGGGG + Intergenic
1153280456 18:3409898-3409920 GAAGGTCTGCTTTGTCCAGGAGG + Intergenic
1158396041 18:57078873-57078895 AAAGCCCTGGACAGCCCAGGAGG - Intergenic
1160095399 18:75867256-75867278 AAATCTATGCAAATTCCAGGAGG - Intergenic
1164451931 19:28373724-28373746 GTAGCTCTGCATATTCCAAGAGG - Intergenic
925032648 2:662786-662808 AAAGCTCTGCAGAGCCAAGGAGG + Intergenic
932075132 2:68655577-68655599 TAAACTTTGCAAAGTCCAGGGGG - Intergenic
932276959 2:70458785-70458807 AAAGGTGGGCATAGTCCTGGGGG - Intronic
937450623 2:121999550-121999572 AAAGCTCTCCACACCCCAGGCGG - Intergenic
942231684 2:173866485-173866507 AAAGCTCAGAAAAGTCCATGTGG + Intergenic
942704409 2:178753706-178753728 AAAGCTGTGCATATTCCTTGTGG - Intronic
942934339 2:181536439-181536461 AAAGCTGTGCAAAGACTAGGGGG + Intergenic
1173063171 20:39681372-39681394 AGAGCTCAGCAGAGTCCAAGAGG - Intergenic
1174517026 20:51100486-51100508 TAGGCTCTGCGCAGTCCAGGAGG + Intergenic
1179290060 21:40010559-40010581 AAGGCCTTGCTTAGTCCAGGAGG + Intergenic
1179531983 21:42026006-42026028 ATAGGTCTGCACAGTCCATGTGG - Intergenic
1184896356 22:47409415-47409437 AAAGCCCTCCATAGCCCAGCGGG + Intergenic
1184987723 22:48146736-48146758 AAAGCCCAGCAGTGTCCAGGAGG + Intergenic
1185346199 22:50311884-50311906 TAAGGTCTGCAGAGGCCAGGTGG + Exonic
950125574 3:10507814-10507836 GAAGCTCTGTGTAGTTCAGGGGG + Intronic
956742278 3:72284692-72284714 AAAGTTCTGCATTGACCAGCAGG + Intergenic
959256275 3:104019119-104019141 CAAGCTCTGGAGAGTCCAGCTGG + Intergenic
960329622 3:116342624-116342646 ACAGCTCTGAATAGTCTAGAAGG - Intronic
961415894 3:126756428-126756450 AAAGCTCTCCATGGTCCAGCTGG - Intronic
961422525 3:126817617-126817639 AAGGCTATGAACAGTCCAGGTGG - Intronic
967360759 3:188628625-188628647 AAAGTTCTGGATAGACCAGATGG + Intronic
967788096 3:193519132-193519154 AAAGATCTGCCTAGTTTAGGTGG - Intronic
970187589 4:13476997-13477019 AAAGTGCTGCATAGTCAAGATGG + Intronic
971424315 4:26501290-26501312 AAAGGTCTGCAAAGTCAAGTAGG - Intergenic
972995201 4:44870529-44870551 AAACCTGTGCAGTGTCCAGGAGG - Intergenic
974340019 4:60603407-60603429 CCAGCTCTGGAGAGTCCAGGTGG - Intergenic
980744978 4:137001240-137001262 AAACCTCTGCTGGGTCCAGGGGG - Intergenic
982837600 4:160141345-160141367 AAAACTCTGCACAGAGCAGGTGG - Intergenic
985873863 5:2580388-2580410 AAGGCTCTCCAGGGTCCAGGTGG + Intergenic
985991773 5:3567650-3567672 CAAAGTCTGCTTAGTCCAGGAGG + Intergenic
987506638 5:18782739-18782761 AAGGCTCTGCATAGCTCTGGGGG - Intergenic
996463183 5:123770618-123770640 ATGGCTCTGAAAAGTCCAGGTGG - Intergenic
997510638 5:134451453-134451475 AATGCTGTGGATGGTCCAGGAGG + Intergenic
998767127 5:145500575-145500597 AAAGCTCTCCATAGTTCTGTGGG - Intronic
999498831 5:152126201-152126223 AAAGCTGTGCACATTCCAGTGGG - Intergenic
1002364135 5:178696983-178697005 AAAAGTCTGCCTAGTCCAAGGGG + Intergenic
1004652199 6:17620793-17620815 AAATCTTTGCCTAGGCCAGGGGG - Intronic
1007682152 6:43641793-43641815 AATGGTATGTATAGTCCAGGTGG + Intergenic
1013115893 6:107103466-107103488 GAAGTTCTCCAGAGTCCAGGAGG - Intronic
1014659479 6:124150114-124150136 AAGGTTCTGCAGAGCCCAGGGGG - Intronic
1015382361 6:132583959-132583981 AAAGCTCTGCATAGGAGAAGGGG + Intergenic
1019089343 6:169513883-169513905 AAAGCTCTAGACAGTACAGGAGG + Intronic
1022602376 7:31773393-31773415 ACAGCTCTGCATATTCTTGGAGG + Intronic
1023347565 7:39287031-39287053 AAAGCTCTGAAAAGTCCCTGGGG - Intronic
1027265356 7:76492222-76492244 AAAGCCCAGCAGAGTCCAGCAGG + Exonic
1027316725 7:76990338-76990360 AAAGCCCAGCAGAGTCCAGCAGG + Intergenic
1029731612 7:102442121-102442143 AAACCTCTGCATAGGCCAGGCGG + Intronic
1030326573 7:108225874-108225896 AAATGTCTGCATATTCCTGGTGG - Intronic
1038609681 8:29048980-29049002 ATAGATGTGCAGAGTCCAGGAGG + Exonic
1039187544 8:34934035-34934057 ACCGTTCTGCATATTCCAGGGGG - Intergenic
1040014855 8:42691777-42691799 AAACCTCCGCAAAGACCAGGAGG - Intergenic
1041560915 8:59216356-59216378 AAACCTGTGCAGAGTCCAGAAGG - Intergenic
1043644496 8:82499805-82499827 ACAGCTCTGCATAGTTGGGGAGG - Intergenic
1044025583 8:87167664-87167686 AAAGCCCTGCATTATCCAGTTGG - Intronic
1044820221 8:96151019-96151041 AAAGCCCTTCACACTCCAGGAGG - Intronic
1048174960 8:132143398-132143420 CTAGCACTGCATAGTCCAGTGGG - Intronic
1049096647 8:140552119-140552141 AAAGCTCTGTATAGAACAGGAGG - Intronic
1053431474 9:38044508-38044530 AAAGCTCTCCATAGAGGAGGTGG + Intronic
1055300375 9:74876416-74876438 AATGTTTTGCATTGTCCAGGTGG - Intronic
1056778371 9:89531171-89531193 AAGGCTCTGCATAGTTTCGGGGG - Intergenic
1056834648 9:89944666-89944688 AACCCTCTGCAAAGCCCAGGGGG + Intergenic
1058935309 9:109764382-109764404 CAAGCTGTGCAAAGGCCAGGAGG - Intronic
1059681493 9:116590474-116590496 ACAGCTCTGCACAGGCCAGCAGG + Intronic
1059889621 9:118786877-118786899 AAAGCTCTGCCTGGTACAGAGGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060673054 9:125487158-125487180 GAAGCTCTGCAGTGTCCTGGAGG - Intronic
1188661220 X:32761199-32761221 AAATCCCTGGATAGGCCAGGTGG - Intronic
1189399451 X:40652958-40652980 AAAGGTCTGCCCAGTCCAAGGGG + Intronic
1193204250 X:78729211-78729233 AAAGCTCTGCAAATTACAGAAGG + Intergenic
1199448991 X:147958635-147958657 AAATCTCTGCAGAGACCATGGGG - Intergenic
1202340491 Y:23859566-23859588 AAAGCTCTTCACAGTGGAGGTGG + Intergenic
1202530275 Y:25810516-25810538 AAAGCTCTTCACAGTGGAGGTGG - Intergenic