ID: 1141820056

View in Genome Browser
Species Human (GRCh38)
Location 16:86439544-86439566
Sequence AGCGCCTGAGACCCCCACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141820054_1141820056 -10 Left 1141820054 16:86439531-86439553 CCGATCTGTGGCCAGCGCCTGAG No data
Right 1141820056 16:86439544-86439566 AGCGCCTGAGACCCCCACGCTGG No data
1141820051_1141820056 30 Left 1141820051 16:86439491-86439513 CCTATTTACCTCTGACTTTGGGA No data
Right 1141820056 16:86439544-86439566 AGCGCCTGAGACCCCCACGCTGG No data
1141820052_1141820056 22 Left 1141820052 16:86439499-86439521 CCTCTGACTTTGGGAGATGAGAT No data
Right 1141820056 16:86439544-86439566 AGCGCCTGAGACCCCCACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141820056 Original CRISPR AGCGCCTGAGACCCCCACGC TGG Intergenic