ID: 1141824352

View in Genome Browser
Species Human (GRCh38)
Location 16:86468552-86468574
Sequence CCGCTCAAGCCAGGATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141824347_1141824352 -1 Left 1141824347 16:86468530-86468552 CCCGCAGTGGACACCAAGAAAGC No data
Right 1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG No data
1141824346_1141824352 0 Left 1141824346 16:86468529-86468551 CCCCGCAGTGGACACCAAGAAAG No data
Right 1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG No data
1141824348_1141824352 -2 Left 1141824348 16:86468531-86468553 CCGCAGTGGACACCAAGAAAGCC No data
Right 1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141824352 Original CRISPR CCGCTCAAGCCAGGATCACA AGG Intergenic
No off target data available for this crispr