ID: 1141825700

View in Genome Browser
Species Human (GRCh38)
Location 16:86478283-86478305
Sequence ATTTAACCAAGCTCCATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141825700_1141825703 23 Left 1141825700 16:86478283-86478305 CCATCAATGGAGCTTGGTTAAAT No data
Right 1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG No data
1141825700_1141825702 20 Left 1141825700 16:86478283-86478305 CCATCAATGGAGCTTGGTTAAAT No data
Right 1141825702 16:86478326-86478348 TCACACAGCTGCCACCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141825700 Original CRISPR ATTTAACCAAGCTCCATTGA TGG (reversed) Intergenic
No off target data available for this crispr