ID: 1141825703

View in Genome Browser
Species Human (GRCh38)
Location 16:86478329-86478351
Sequence CACAGCTGCCACCAAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141825700_1141825703 23 Left 1141825700 16:86478283-86478305 CCATCAATGGAGCTTGGTTAAAT No data
Right 1141825703 16:86478329-86478351 CACAGCTGCCACCAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141825703 Original CRISPR CACAGCTGCCACCAAGATGG AGG Intergenic
No off target data available for this crispr