ID: 1141827191

View in Genome Browser
Species Human (GRCh38)
Location 16:86488863-86488885
Sequence TCGTGAAGTGACCGGCTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141827188_1141827191 3 Left 1141827188 16:86488837-86488859 CCAAAAGGTGCTTCGAGGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1141827191 16:86488863-86488885 TCGTGAAGTGACCGGCTGACGGG 0: 1
1: 0
2: 0
3: 0
4: 30
1141827185_1141827191 30 Left 1141827185 16:86488810-86488832 CCTACTTCTAAGCTACACAACTG 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1141827191 16:86488863-86488885 TCGTGAAGTGACCGGCTGACGGG 0: 1
1: 0
2: 0
3: 0
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141827191 Original CRISPR TCGTGAAGTGACCGGCTGAC GGG Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
910656540 1:89625075-89625097 TCGGGAAGATACTGGCTGACTGG + Intergenic
912967577 1:114249802-114249824 TGGTGAAGGCACCGGCTGGCAGG - Intergenic
919376413 1:196799647-196799669 TCGTGAAGTACCCATCTGACAGG - Intergenic
921824726 1:219659925-219659947 TCCTGAAGTCACCAGCTGAGAGG + Intergenic
1072808915 10:98444958-98444980 CGGAGAAGTGACCGGCTGGCTGG + Intronic
1130929956 15:88417513-88417535 TGGTGAAGGGACAGGCTGATAGG + Intergenic
1141168475 16:81676313-81676335 TCTTGAAGGGACTGGCTGAGGGG - Intronic
1141827191 16:86488863-86488885 TCGTGAAGTGACCGGCTGACGGG + Intergenic
1164242872 19:23405530-23405552 TAGTGAAGTCACCGACTCACAGG + Intergenic
1175151980 20:56942027-56942049 GCCTGAAGTGACAGGCTGAGAGG + Intergenic
1181053202 22:20247285-20247307 CTGTGACGTGACCGCCTGACGGG - Intronic
1182519201 22:30875917-30875939 TCTTAAAGTGACAGGCTGCCAGG + Intronic
1184136355 22:42552254-42552276 GCGAGAAGTGACCGGAAGACAGG - Intergenic
950584126 3:13880533-13880555 TCGCGGAGCGACGGGCTGACTGG + Intergenic
950771116 3:15311987-15312009 TGGTGAAGTGACTGGCACACTGG - Intronic
956077706 3:65523529-65523551 TCCTGGAGTGACCAGGTGACTGG + Intronic
969298297 4:6282201-6282223 TCGTGAATGGACAGGCTGAATGG - Intronic
973339112 4:48986221-48986243 TCGTGAAGGGGCGGGCGGACCGG + Intergenic
975814108 4:78199659-78199681 TCGTGAGAAGACCTGCTGACTGG + Intronic
981432124 4:144673129-144673151 TGGTGAAATGACTGGCTCACAGG - Intronic
1001578941 5:172785183-172785205 TCGTGAAGTGATAGGATTACAGG + Intergenic
1011227829 6:85127162-85127184 CCGAGAAGTGATCGGATGACTGG + Intergenic
1017299584 6:152840909-152840931 ACGTGAAGTGATCAGCTTACAGG + Intergenic
1041139373 8:54799438-54799460 TAGTGAAATGACAGGCTGCCAGG - Intergenic
1048023751 8:130565023-130565045 AAGTGAAGTGACTGGCTGAAAGG - Intergenic
1049044780 8:140140889-140140911 TAGAGAAGTGACTGGCTGAGGGG - Intronic
1049376731 8:142292910-142292932 CCGTGAAGAGCCCGACTGACAGG - Intronic
1049428828 8:142549885-142549907 CCCTGAAGGGACCGGCAGACAGG + Intergenic
1061036555 9:128117600-128117622 TCCTGAAGTGCCGGGCTTACAGG + Intergenic
1187186014 X:16986632-16986654 TCATTAAGTGACCTGCTCACTGG + Intronic