ID: 1141829483

View in Genome Browser
Species Human (GRCh38)
Location 16:86501752-86501774
Sequence TGGTCCTCATGTCAGCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141829468_1141829483 25 Left 1141829468 16:86501704-86501726 CCCCACCCCTGCCAGACCCTGCA No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829477_1141829483 9 Left 1141829477 16:86501720-86501742 CCCTGCAGGACGCACTTCAGGTG No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829475_1141829483 14 Left 1141829475 16:86501715-86501737 CCAGACCCTGCAGGACGCACTTC No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829469_1141829483 24 Left 1141829469 16:86501705-86501727 CCCACCCCTGCCAGACCCTGCAG No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829467_1141829483 26 Left 1141829467 16:86501703-86501725 CCCCCACCCCTGCCAGACCCTGC No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829472_1141829483 20 Left 1141829472 16:86501709-86501731 CCCCTGCCAGACCCTGCAGGACG No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829473_1141829483 19 Left 1141829473 16:86501710-86501732 CCCTGCCAGACCCTGCAGGACGC No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829466_1141829483 29 Left 1141829466 16:86501700-86501722 CCACCCCCACCCCTGCCAGACCC No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829478_1141829483 8 Left 1141829478 16:86501721-86501743 CCTGCAGGACGCACTTCAGGTGT No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829474_1141829483 18 Left 1141829474 16:86501711-86501733 CCTGCCAGACCCTGCAGGACGCA No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829465_1141829483 30 Left 1141829465 16:86501699-86501721 CCCACCCCCACCCCTGCCAGACC No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data
1141829470_1141829483 23 Left 1141829470 16:86501706-86501728 CCACCCCTGCCAGACCCTGCAGG No data
Right 1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141829483 Original CRISPR TGGTCCTCATGTCAGCTCTG TGG Intergenic
No off target data available for this crispr