ID: 1141829819

View in Genome Browser
Species Human (GRCh38)
Location 16:86503996-86504018
Sequence CACTTAGCACAGATGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141829819_1141829828 -6 Left 1141829819 16:86503996-86504018 CCCAGTCCCATCTGTGCTAAGTG No data
Right 1141829828 16:86504013-86504035 TAAGTGGGTGTGACAGGGCTGGG No data
1141829819_1141829827 -7 Left 1141829819 16:86503996-86504018 CCCAGTCCCATCTGTGCTAAGTG No data
Right 1141829827 16:86504012-86504034 CTAAGTGGGTGTGACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141829819 Original CRISPR CACTTAGCACAGATGGGACT GGG (reversed) Intergenic
No off target data available for this crispr