ID: 1141830682

View in Genome Browser
Species Human (GRCh38)
Location 16:86508602-86508624
Sequence CGGGCGCGGCCTCTCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141830682_1141830689 12 Left 1141830682 16:86508602-86508624 CCTGGAGGGAGAGGCCGCGCCCG 0: 1
1: 1
2: 2
3: 33
4: 285
Right 1141830689 16:86508637-86508659 TGCGAGAGCAGCACTCACCTGGG 0: 1
1: 0
2: 0
3: 11
4: 100
1141830682_1141830688 11 Left 1141830682 16:86508602-86508624 CCTGGAGGGAGAGGCCGCGCCCG 0: 1
1: 1
2: 2
3: 33
4: 285
Right 1141830688 16:86508636-86508658 CTGCGAGAGCAGCACTCACCTGG 0: 1
1: 0
2: 1
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141830682 Original CRISPR CGGGCGCGGCCTCTCCCTCC AGG (reversed) Intergenic