ID: 1141830682

View in Genome Browser
Species Human (GRCh38)
Location 16:86508602-86508624
Sequence CGGGCGCGGCCTCTCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141830682_1141830688 11 Left 1141830682 16:86508602-86508624 CCTGGAGGGAGAGGCCGCGCCCG 0: 1
1: 1
2: 2
3: 33
4: 285
Right 1141830688 16:86508636-86508658 CTGCGAGAGCAGCACTCACCTGG 0: 1
1: 0
2: 1
3: 7
4: 125
1141830682_1141830689 12 Left 1141830682 16:86508602-86508624 CCTGGAGGGAGAGGCCGCGCCCG 0: 1
1: 1
2: 2
3: 33
4: 285
Right 1141830689 16:86508637-86508659 TGCGAGAGCAGCACTCACCTGGG 0: 1
1: 0
2: 0
3: 11
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141830682 Original CRISPR CGGGCGCGGCCTCTCCCTCC AGG (reversed) Intergenic
900158711 1:1213472-1213494 GGGGCACCCCCTCTCCCTCCGGG - Intronic
900284253 1:1891484-1891506 CGGGCGGGGGCGGTCCCTCCGGG + Intergenic
900553032 1:3265937-3265959 TGGGCCTGGCCTCGCCCTCCTGG - Intronic
900967892 1:5972066-5972088 CGGCTGCGGCCTCTTCATCCAGG - Intronic
900999625 1:6142328-6142350 CGGCATCGGCCTCTCTCTCCAGG - Exonic
901513433 1:9729869-9729891 CGGGGTGGGCCTCTCCCTCTGGG + Exonic
902614499 1:17616395-17616417 CAGGCGTGGCCTGTCCCTTCTGG + Intronic
902916713 1:19644172-19644194 CGCGCGCGGCCTCTCCCTCCGGG - Intronic
904297703 1:29532375-29532397 CAGGCGAGGCCTCTCCCCCATGG - Intergenic
905189669 1:36224109-36224131 GGGGCTCAGACTCTCCCTCCAGG + Intergenic
905626103 1:39491528-39491550 CGGGCGCGGCCTCCGCGCCCAGG + Intergenic
906407151 1:45551021-45551043 CGGCCCCTGCCCCTCCCTCCGGG + Exonic
912429263 1:109620553-109620575 CGGGACAGGCCCCTCCCTCCTGG + Intronic
912682982 1:111740449-111740471 CGGGCGCGGCGTCTCCGCGCTGG - Intronic
912955843 1:114153681-114153703 CGGGCCCGGCCGCCCCCTCTCGG - Intronic
913451097 1:118993183-118993205 TGGGCGCGGCCGCTCCGGCCTGG - Intergenic
914492383 1:148160484-148160506 CCCGCGCGCCCTCTCCCTACCGG - Intergenic
918851476 1:189696454-189696476 TGGCTGCGGCCTCTGCCTCCTGG - Intergenic
919678470 1:200409904-200409926 AGGCCTCGCCCTCTCCCTCCTGG + Intronic
920560562 1:206935615-206935637 CGAGGGCCGCCTCTCCCTGCTGG - Exonic
921060356 1:211579397-211579419 GGGGCGGGGCCTTTTCCTCCCGG + Intergenic
921073925 1:211684757-211684779 AGGGTGCGGGCTCTTCCTCCTGG - Intergenic
921075682 1:211698663-211698685 TGGGGGCGCCCTCTCCCTCCTGG + Intergenic
924948670 1:248863384-248863406 CGGGTGCAGCCTCTGCCGCCCGG + Intergenic
1062973540 10:1666185-1666207 CGGGGTCTTCCTCTCCCTCCCGG - Intronic
1067015228 10:42753316-42753338 CCAGCGCGGCCTCCTCCTCCAGG + Intergenic
1067015670 10:42755071-42755093 CGGCGGCGGCCTCTGCTTCCCGG + Intergenic
1067078744 10:43202479-43202501 CCCGCGCGGCCTCTGCCCCCGGG + Intronic
1067286637 10:44912045-44912067 CAGGCTCAGCCTGTCCCTCCAGG - Intronic
1069755833 10:70774075-70774097 GGGGCTGGGCCTCTGCCTCCAGG + Intronic
1070249874 10:74764396-74764418 CGGGGGCGGCCACCCCCTGCTGG + Intergenic
1070544072 10:77438999-77439021 TGGGCTCGGCCTCGGCCTCCCGG - Intronic
1072294244 10:93994051-93994073 CGCGCCCGGGCTCTACCTCCCGG + Intronic
1072731470 10:97849903-97849925 GGGCCGCGGCTTCCCCCTCCCGG + Intergenic
1072731524 10:97850051-97850073 CGGGCGCGGCCTCGCCTCCCGGG + Intergenic
1073048750 10:100654852-100654874 CCGGCGCGGCCTGCGCCTCCCGG + Intergenic
1075270253 10:121043202-121043224 CTGGAGCCCCCTCTCCCTCCAGG + Intergenic
1075724620 10:124604970-124604992 CGGGTGCGGCCTCTCCCCGAGGG - Intronic
1076218680 10:128715987-128716009 CGGGCGCAGCCTCTCTCTCCGGG - Intergenic
1076611254 10:131727188-131727210 CGGGGGCGCCCTCTCCTTCCAGG + Intergenic
1076659294 10:132044601-132044623 CTGGCGCGGGCTCTTCCTCAGGG + Intergenic
1076704200 10:132292330-132292352 CGGCCTCGGCCTCTCCATCCGGG + Intronic
1076750082 10:132538037-132538059 CGGCGGCGGCCGCTTCCTCCGGG - Exonic
1077093497 11:789872-789894 CGGCCGCCGCCTCCCTCTCCCGG + Intronic
1077102969 11:830346-830368 CGGGCCCCGCCCCTCCCGCCAGG + Intronic
1077268890 11:1665945-1665967 CGGGCCCGCCCTCAGCCTCCAGG - Intergenic
1077271862 11:1685235-1685257 CGGGCCCGCCCTCAGCCTCCAGG + Intergenic
1077390661 11:2299355-2299377 TGAGCGCGGCCCCTCCCACCGGG - Intronic
1077486276 11:2839753-2839775 CGAGCGCGACCTCTCCGACCAGG + Intronic
1084715614 11:70871526-70871548 CAGGCACAGCCTCTCCCTCCAGG - Intronic
1084719423 11:70894740-70894762 CTGGCGGGGGCTCTGCCTCCAGG + Intronic
1085054263 11:73394788-73394810 GGGGCCCTGCCTCCCCCTCCCGG - Intronic
1085059355 11:73430565-73430587 CGGGCGCAGCCTCTCCAGGCTGG - Intronic
1089622035 11:119727872-119727894 CTGCCCCGGCCTCACCCTCCAGG + Intronic
1090840951 11:130487159-130487181 CGTGCTGGGCCTCTCCCTGCAGG + Intergenic
1091460922 12:642995-643017 CCGCCGCGGCCTCTTCCGCCCGG + Intronic
1092160119 12:6311212-6311234 CGAGGGCGGGCCCTCCCTCCAGG + Intronic
1093894696 12:24562769-24562791 CGGGGGCTCCCGCTCCCTCCAGG + Intergenic
1096157182 12:49347221-49347243 GGGCTGCGGCCTCGCCCTCCTGG + Exonic
1097264544 12:57737901-57737923 CGGCCGCCGCCTCTCCCTCTGGG - Exonic
1097791721 12:63822117-63822139 CGGGCTCATCCTCTCCATCCGGG + Intergenic
1098342878 12:69470280-69470302 GGGGCGGGGCCTCTCTCGCCGGG - Intergenic
1100431290 12:94533998-94534020 GTGGCGCAGCCTTTCCCTCCAGG + Intergenic
1102768268 12:115451853-115451875 CGGGGCCCGCCTCTCCCTGCAGG + Intergenic
1103085752 12:118061002-118061024 CGGGCGCGCCCGTTCCCGCCCGG - Intronic
1103534704 12:121626640-121626662 CGGGCCCGGCCTCACCCGGCCGG - Exonic
1104987314 12:132604223-132604245 CGGGCGGGGGCTCAGCCTCCAGG - Intronic
1105327340 13:19382414-19382436 CGGGCGCCGGCTGCCCCTCCGGG - Intergenic
1106143888 13:27034998-27035020 CGAGAGCGGCCACTCCTTCCTGG - Intergenic
1106157532 13:27171876-27171898 AGGGCGCAGCCGCTGCCTCCGGG + Exonic
1106208314 13:27620139-27620161 CGGGCGCCGACTCTCCCTCCTGG + Intronic
1108227416 13:48303756-48303778 CGGACGCGCCCTCCCCCGCCCGG - Exonic
1108484373 13:50909801-50909823 GGGCCGCGGCCTCTCCCTCGCGG - Exonic
1110085961 13:71380107-71380129 CTTGGGCTGCCTCTCCCTCCGGG - Intergenic
1112504590 13:99968492-99968514 AGGGCGTGGCCTGTCCCGCCGGG + Intronic
1113861688 13:113491064-113491086 GGGCGGCGGCCGCTCCCTCCCGG + Exonic
1114069768 14:19097705-19097727 CGGCGGCGGCCTCTGCTTCCCGG - Intergenic
1114092494 14:19302298-19302320 CGGCGGCGGCCTCTGCTTCCCGG + Intergenic
1114181971 14:20375229-20375251 ATGGCGCGACCTCTGCCTCCCGG + Intronic
1114231424 14:20786243-20786265 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1114659158 14:24333931-24333953 CGGGCGCGGCCAATCCTTGCTGG - Intronic
1118366478 14:65101769-65101791 CGAGCGCCGCCCCTCCTTCCGGG + Intronic
1119385976 14:74258404-74258426 CCGGCGCCGCCCTTCCCTCCGGG - Intronic
1119743500 14:77028425-77028447 TGGCCGCGGCGGCTCCCTCCGGG - Exonic
1121433937 14:93906520-93906542 CTGGCCTGGCCTCTCCCACCCGG + Intergenic
1121562562 14:94885938-94885960 CTGGCTGAGCCTCTCCCTCCAGG - Intergenic
1121645890 14:95516750-95516772 GGGGCGCGGCCTCTCCCGCGGGG - Intronic
1122130978 14:99604401-99604423 CGGCCGCGGTCCCGCCCTCCCGG + Intergenic
1122771456 14:104099714-104099736 CGGGAGCATCCCCTCCCTCCTGG + Intronic
1123168426 14:106348455-106348477 AGGGAGCTGCTTCTCCCTCCAGG + Intergenic
1123171005 14:106372845-106372867 AGGGGGCTGCTTCTCCCTCCAGG + Intergenic
1123176120 14:106420867-106420889 AGGGGGCTGCTTCTCCCTCCAGG + Intergenic
1202947565 14_KI270726v1_random:42696-42718 AGGGGGCTGCTTCTCCCTCCAGG - Intergenic
1123676390 15:22714477-22714499 CGGCCGCGGCGTCGTCCTCCGGG - Intergenic
1123710065 15:22980420-22980442 CCGGCTCGGCCTCTTCCTCCCGG + Intronic
1126348354 15:47718815-47718837 CGCGAGCGGCGGCTCCCTCCCGG - Exonic
1128119203 15:65133444-65133466 CGGCCGCGGCCACCGCCTCCCGG - Exonic
1131048765 15:89333196-89333218 CGGGTACGGCCTCCCCCTCGGGG + Exonic
1131594611 15:93784349-93784371 CTGGCCCTGCCTCTTCCTCCAGG - Intergenic
1132519928 16:382193-382215 CCGGCGCGACCTCTCCGTCCTGG - Intronic
1132523445 16:401908-401930 CGGGAGCGGCCTCGGCCTCCAGG - Exonic
1132584477 16:700320-700342 AGGGCCCGGCCTCACCTTCCAGG - Intronic
1132629698 16:911324-911346 AGAGCGGGGCCTTTCCCTCCAGG - Intronic
1132723763 16:1330074-1330096 AGGGCCTGGCCTCTCCCTGCTGG + Intergenic
1132759000 16:1499952-1499974 TGGGGGCGGCCACTGCCTCCTGG - Intronic
1133014965 16:2935427-2935449 TGGGCCCGGCCTCTGCCCCCAGG - Intronic
1133056870 16:3149781-3149803 CCGGCGCCGGCTCTGCCTCCAGG + Exonic
1133137657 16:3723117-3723139 TGGGCGCAGCCTCTGCTTCCCGG + Intergenic
1133282685 16:4676171-4676193 GGCGGCCGGCCTCTCCCTCCAGG - Intronic
1133973086 16:10580765-10580787 CGGCCTCGGCCTTTCCCTCCAGG - Intergenic
1137559237 16:49492461-49492483 CGGCCCCGGCCTCGGCCTCCGGG - Intronic
1139549723 16:67666654-67666676 CGCTCGCGGCCTCTCCCCCGCGG + Exonic
1139844317 16:69908828-69908850 TGGGAGCGGCCCCTTCCTCCAGG + Exonic
1140906872 16:79416577-79416599 GGGGTACGGCCACTCCCTCCTGG - Intergenic
1141054914 16:80804956-80804978 GCTGCGCGGCCCCTCCCTCCAGG + Intergenic
1141723331 16:85769075-85769097 CGGCTGCAGCCTCTGCCTCCCGG - Intergenic
1141830682 16:86508602-86508624 CGGGCGCGGCCTCTCCCTCCAGG - Intergenic
1142050238 16:87953072-87953094 TGGACGCAGCCTCTGCCTCCTGG - Intronic
1142582030 17:948976-948998 CGGGCTCCTCCTCTCCCCCCGGG + Intronic
1142582039 17:948995-949017 CGGGCTCCTCCTCTCCCCCCGGG + Intronic
1143150768 17:4806859-4806881 CGTGCCCGGCCGCTGCCTCCCGG - Intergenic
1143405984 17:6677488-6677510 CGGGCTGGGCCTCACCATCCTGG + Intergenic
1143544560 17:7588690-7588712 GGGCCGCGGGCTCTCCATCCCGG - Intronic
1143719438 17:8799334-8799356 CCCGCCCCGCCTCTCCCTCCGGG - Exonic
1145083717 17:19917548-19917570 CAGCCGCAGCCTCACCCTCCTGG + Intronic
1145750076 17:27349292-27349314 CAGGCGCCGCCTCTCCCTTACGG - Intergenic
1146132683 17:30292123-30292145 CAGGCGCGGCCTCAGCCCCCGGG - Intergenic
1147183574 17:38702098-38702120 GGGGTGCGACCTCTCCCTCTGGG - Intergenic
1148246031 17:46031553-46031575 TGGGCGCTGCCTCTGTCTCCCGG + Exonic
1148384277 17:47223059-47223081 TGAGTGCAGCCTCTCCCTCCTGG + Intronic
1150272157 17:63873546-63873568 AGGGCGCTGCCTCTCCCCTCAGG + Intronic
1150275705 17:63896443-63896465 AGGGCGCTGCCTCTCCCCTCAGG + Intronic
1150277835 17:63911128-63911150 AGGGCGCCGCCTCTCCCCTCAGG + Intronic
1152069731 17:78128622-78128644 CGCGCGCGGCCCCTCCTCCCCGG - Exonic
1152226282 17:79094363-79094385 AGGGCTCGGCCTCTCCCCCAAGG + Intronic
1152631561 17:81412975-81412997 CGGGTGCGGCCTCACCTTGCGGG + Intronic
1152729676 17:81963274-81963296 CGGAGGAGGCCTCTCCCGCCGGG + Intergenic
1152783062 17:82234938-82234960 CCGGCTCAGCCTCTCCCTGCTGG - Exonic
1152927772 17:83095481-83095503 TGGGCAGAGCCTCTCCCTCCAGG + Intergenic
1157383860 18:47246816-47246838 CGGGGGCGGCCGGTTCCTCCAGG - Intronic
1160100729 18:75917073-75917095 CGGGCGCGGTGGCTCCCGCCTGG + Intergenic
1160810623 19:1011499-1011521 CCGGCGCCGCCTCTCCCTGCAGG - Exonic
1160822981 19:1066999-1067021 AGGGCGCTGACTCTCACTCCCGG - Intronic
1161325744 19:3663140-3663162 CGGGCGCGGAGGCTCACTCCTGG - Intronic
1162757268 19:12867760-12867782 GGGGACTGGCCTCTCCCTCCAGG - Exonic
1162932176 19:13962712-13962734 CGCGCGCGGCCTCTTCGTGCAGG - Exonic
1163607114 19:18281510-18281532 AGGCCGCGGCCACTCCCCCCCGG - Exonic
1164551040 19:29212820-29212842 CGCCCGCGGCCGCTCCCTGCTGG + Intronic
1164632913 19:29773382-29773404 CGGCTCCGGCCACTCCCTCCCGG + Intergenic
1164753013 19:30670045-30670067 CGGGCCCGCCCTCTCCCACCTGG - Intronic
1165591396 19:36972889-36972911 CGGGCCCGGCCGCCCCTTCCCGG + Intronic
1165748711 19:38246915-38246937 TGGGCGCGGTGTCTCCCACCTGG + Intronic
1166354144 19:42217185-42217207 CGGGCGGGACCATTCCCTCCCGG - Intronic
1166555889 19:43699711-43699733 CGGCCTCCGCCTCTCCCTCCCGG + Intergenic
1166564131 19:43753533-43753555 TGGCTGCGGCCTCTGCCTCCCGG + Intronic
1167173462 19:47849151-47849173 GGGGCACGGCCCCTCCCTCAGGG - Intergenic
1167181127 19:47904264-47904286 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167181795 19:47909624-47909646 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167182444 19:47915014-47915036 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167183112 19:47920366-47920388 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167183780 19:47925716-47925738 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167184409 19:47930766-47930788 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167185081 19:47936117-47936139 CGGGCGCGGCGGCTCACTCCTGG + Intergenic
1167185734 19:47941506-47941528 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167186401 19:47946861-47946883 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167187052 19:47952252-47952274 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167187702 19:47957635-47957657 CGGGCGCGGTGGCTCACTCCTGG + Intergenic
1167542139 19:50095997-50096019 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167543011 19:50102127-50102149 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167543447 19:50105190-50105212 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167544120 19:50110534-50110556 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167544795 19:50115887-50115909 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167545470 19:50121239-50121261 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167546147 19:50126594-50126616 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167546824 19:50131929-50131951 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167547482 19:50137302-50137324 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1167866991 19:52336666-52336688 AGGACGCGGCCTCCCCCGCCGGG - Intronic
1168315314 19:55482414-55482436 CGGCCGCGGCCTCTTCCACGTGG - Exonic
1168710865 19:58499256-58499278 GAGGCGGGGCCTCTCCTTCCCGG - Intronic
926095948 2:10080521-10080543 CGGGCGCGGCCTCCCCTCCCGGG + Intronic
927184592 2:20473235-20473257 GGGGGGCGGCCTCTCCCTACAGG - Intergenic
931762455 2:65430674-65430696 CGCGCGCGGGGCCTCCCTCCAGG + Intronic
936976179 2:118224506-118224528 GGGGCGCGGCCTTTGCCGCCTGG + Intergenic
938059118 2:128238468-128238490 AGGGCCCGGCCTCCCCCACCTGG - Intronic
938539995 2:132278030-132278052 CTGCCGCTGCCTCTGCCTCCAGG - Intergenic
942454596 2:176129536-176129558 CCGCCGCGGCCCCTCCCTGCCGG + Intergenic
946248135 2:218398658-218398680 CGGGCGCGTCCTGTCCCGTCCGG - Intronic
947552568 2:231057065-231057087 CGGCGGCGGCTCCTCCCTCCAGG - Intronic
948206895 2:236167347-236167369 GGGGCGCGGCCTCGCCCCCTTGG + Intronic
948806097 2:240453930-240453952 GGGGCGCGGACCCTCCCACCCGG + Intronic
948880838 2:240856377-240856399 CCGGCTCCGCCTCTCCCACCTGG - Intergenic
1169131124 20:3166909-3166931 GCGGCCCGGCCTCTCCCTGCTGG + Exonic
1169131435 20:3168104-3168126 AGGGCACAGCCTGTCCCTCCCGG + Intronic
1169425983 20:5497766-5497788 CAGGCGGGGCTGCTCCCTCCAGG - Intergenic
1170991148 20:21303109-21303131 CGCGCTCGGCCTCGCGCTCCGGG + Intergenic
1171210138 20:23310476-23310498 CTGGGCCGGACTCTCCCTCCAGG + Intergenic
1172840830 20:37902013-37902035 CGGGCGAGGCCCCTGACTCCTGG - Intergenic
1173322309 20:41999021-41999043 GGGCCGCTGCCTCGCCCTCCAGG + Intergenic
1174007990 20:47425861-47425883 CGGGCGCGGTGGCTCACTCCTGG - Intergenic
1174339992 20:49889506-49889528 CGGGCCTGGCCTCTCATTCCTGG - Exonic
1175443683 20:59006909-59006931 CAGGCGCGCGCTCTGCCTCCTGG - Intronic
1175549593 20:59808568-59808590 GGGGCACTGTCTCTCCCTCCAGG - Intronic
1175815781 20:61882585-61882607 GGGGTGCAGCCCCTCCCTCCCGG + Intronic
1175889077 20:62308172-62308194 TGGGCCCGGCCTCTACCTGCTGG - Exonic
1176217562 20:63955595-63955617 TGGGCGCTGCCCCTCCCTTCCGG - Intronic
1176246983 20:64102165-64102187 CGGCCTCGGACCCTCCCTCCAGG + Intergenic
1176409226 21:6438754-6438776 CGGGCGCGGCTGCTCACGCCTGG - Intergenic
1176868673 21:14070817-14070839 CGGGCCCGGCCACGCCCGCCTGG - Intergenic
1179684721 21:43047076-43047098 CGGGCGCGGCTGCTCACGCCTGG - Intergenic
1179931188 21:44572046-44572068 CGGCCGCGGCCCATCCCTCGCGG - Intronic
1179994227 21:44966611-44966633 CTGGGGAGCCCTCTCCCTCCTGG + Intronic
1180235932 21:46459299-46459321 CCCGCGCGGCCCCTCACTCCAGG + Intronic
1180488235 22:15820268-15820290 CGGCGGCGGCCTCTGCTTCCCGG - Intergenic
1181318199 22:21984848-21984870 CGAGCTCCTCCTCTCCCTCCAGG + Intergenic
1181606828 22:23985193-23985215 CGGGCGTGGCCTCTCTCTTATGG - Intergenic
1181941888 22:26483992-26484014 GGGGCGCCGCCTCTCTCCCCCGG - Exonic
1181941897 22:26484013-26484035 GGGGCGCCGCCTCTCTCCCCCGG - Exonic
1182257647 22:29050124-29050146 CGGGCCCTGCCTCTCCCTCGGGG + Exonic
1183485028 22:38084036-38084058 CGGCGGCGGCCCCTCCCTGCAGG - Intronic
1183966633 22:41446414-41446436 GCGGGGCGGCTTCTCCCTCCAGG + Exonic
1184417829 22:44362418-44362440 AGGGCCCGGCTTCTGCCTCCAGG + Intergenic
1185074867 22:48677766-48677788 CGGGCGTGGCGTCCCCCTCCTGG + Intronic
1185228843 22:49668579-49668601 CGGGCCCCGCATCTCCCGCCTGG - Intergenic
954798736 3:53174972-53174994 TGGGCTCTGCCTCACCCTCCTGG + Intronic
955047934 3:55377336-55377358 AGGGCCAGGCCTGTCCCTCCTGG - Intergenic
959357749 3:105353994-105354016 CGGGCTCAGTCTCTCCCTCCTGG - Intergenic
961650555 3:128414809-128414831 TGGGCATGGCGTCTCCCTCCTGG - Intergenic
961762828 3:129184064-129184086 CGCGCGCGGCCTTTCACGCCGGG + Intergenic
961780061 3:129316013-129316035 CGGCCGCGGCCGCTCCCGCCTGG - Exonic
967952005 3:194848321-194848343 CGGGCGCGGCGGCTCACACCTGG + Intergenic
967982131 3:195072028-195072050 TGGGTGAGTCCTCTCCCTCCTGG - Intronic
968082210 3:195854350-195854372 CGGGCGCGGCGGCTCACGCCTGG + Intergenic
968520339 4:1032193-1032215 CTGGCCCGGCCTCTCCTTCCTGG + Intergenic
968944090 4:3654566-3654588 CGGGTGGGGCCTCTCCTCCCGGG - Intergenic
969468266 4:7370640-7370662 CTGGCGCGGCCCCTGCCTGCCGG + Intronic
969649971 4:8460240-8460262 TGGGAGTGGCCTCTCCCTCTGGG + Intronic
973820382 4:54657741-54657763 CGCGCGCGCCCTCCTCCTCCCGG + Intergenic
979624101 4:122827021-122827043 CGGGCGCGGCCGCGCGCTGCCGG + Exonic
981128487 4:141132921-141132943 CGGCCGCGGCCCCTCCGGCCCGG - Intronic
983999131 4:174218640-174218662 TGGCCACCGCCTCTCCCTCCAGG - Intergenic
985345671 4:189001992-189002014 GAGGCGCGGCCTCTGCCTCAGGG + Intergenic
985471782 5:51100-51122 CGGCCTCGCCCTCTCCGTCCCGG + Intergenic
985573244 5:661967-661989 GGCGTGGGGCCTCTCCCTCCAGG + Exonic
985749838 5:1667621-1667643 GGGGCGCGCGTTCTCCCTCCGGG + Intergenic
985892507 5:2726560-2726582 TGTGAGCAGCCTCTCCCTCCAGG - Intergenic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
993901347 5:93585666-93585688 CTGCCGCTGCCTCCCCCTCCCGG + Intronic
997066305 5:130563797-130563819 CGGGCGCGGTGGCTCCCGCCTGG - Intergenic
997521516 5:134526808-134526830 CGGGGGCAGCCTCCACCTCCGGG + Intronic
998018885 5:138753534-138753556 CGGGCGCGGTCTCTCGGGCCAGG + Intronic
1001554272 5:172625487-172625509 TGGGGGCGGCCCCTCCATCCAGG - Intergenic
1001617920 5:173057080-173057102 CGGGCGAGGGGCCTCCCTCCCGG + Intronic
1002334513 5:178468626-178468648 CGGACCCGGCCCTTCCCTCCAGG - Intronic
1003325228 6:5085665-5085687 GGGGGGCGGCCTCTTCCTTCGGG - Exonic
1004241392 6:13925183-13925205 CGCGCGCGGAGTCTCCCTCCGGG + Intronic
1006092285 6:31635141-31635163 CGGGAGCAGCCTCTGCCCCCTGG + Exonic
1006837081 6:37005555-37005577 CGGGCCCCACCTCTCCCTCAGGG - Intergenic
1007248956 6:40482750-40482772 CAGGCCCTGCCTCCCCCTCCTGG + Intronic
1007791822 6:44313417-44313439 AGGGGGCGGCCTCTGCCGCCGGG + Intronic
1013619402 6:111873235-111873257 GCGGCGCGTCCTCTCCCGCCCGG - Exonic
1015244554 6:131062660-131062682 CGGCCGCGGCGTCGCCCTTCAGG - Intronic
1015525927 6:134175401-134175423 CGCGCGCGACCTCGCCCGCCAGG + Intronic
1016328155 6:142926755-142926777 GGGGCGCGCGTTCTCCCTCCCGG + Intronic
1018848823 6:167573211-167573233 CGGGTGCCTCCTCTGCCTCCTGG + Intergenic
1019313394 7:373687-373709 CAGGTGCGGCCTCTGCGTCCAGG - Intergenic
1019585480 7:1799891-1799913 CGGGCGCGGTCTCTCATGCCTGG + Intergenic
1019733188 7:2638500-2638522 CGGGCTGGCCCTCACCCTCCAGG - Intronic
1019744213 7:2690535-2690557 CTGGCGTGGCCACTCCTTCCCGG + Intronic
1019754592 7:2759793-2759815 AGGGCTGGGCCGCTCCCTCCAGG + Intronic
1019894379 7:3972353-3972375 CGGGCACGGCAGCTCACTCCTGG - Intronic
1020073155 7:5240617-5240639 CGGAGGGCGCCTCTCCCTCCGGG + Intergenic
1020118032 7:5487290-5487312 TGGACGGGGCCTCTCCCACCTGG + Intronic
1023881474 7:44323933-44323955 TGGGCTCGCCCTCTCCCTCGAGG + Intronic
1025176106 7:56803256-56803278 CAGGCCCGGCCTCTACCTCATGG - Intergenic
1025695688 7:63773166-63773188 CAGGCCCGGCCTCTACCTCATGG + Intergenic
1026529737 7:71186423-71186445 TGAGCGGGGCCTCTGCCTCCTGG + Intronic
1028477197 7:91265192-91265214 CGAGCGGGGCATCTCCGTCCCGG + Exonic
1029206103 7:98870130-98870152 CGGCCGCGTCCTCCCTCTCCGGG + Intronic
1029432387 7:100539576-100539598 CGACCTCGGCCACTCCCTCCCGG - Intronic
1031899171 7:127391866-127391888 CGGCTGCGGCCTCGCCGTCCCGG + Intronic
1031918909 7:127587722-127587744 CGGGCCCCGCCTCTCAGTCCAGG - Intronic
1034275497 7:149822081-149822103 CGGGCCTGGCCTCTCGCTCTGGG + Intergenic
1034340359 7:150349647-150349669 CGGGCGCGGTGTCTCACGCCTGG + Intergenic
1035167326 7:156999752-156999774 CGGGCGGGGCCTCTCCAGCCCGG - Intronic
1035865093 8:3074009-3074031 CGGGCGTGGCCTCACCCTGAGGG + Intronic
1037819967 8:22130772-22130794 CCGGCGCCTTCTCTCCCTCCGGG - Exonic
1041475549 8:58261046-58261068 TTGGCGCAGCCTCTACCTCCTGG - Intergenic
1041687086 8:60653530-60653552 GGGGCGCGGCGTCTCCCACCTGG + Intergenic
1045277526 8:100721460-100721482 CGGGCCCATCCTCTCCATCCGGG - Exonic
1047499460 8:125430571-125430593 CCGCCGCCGCCTCTGCCTCCCGG + Exonic
1049271325 8:141697786-141697808 AGGGTCAGGCCTCTCCCTCCAGG - Intergenic
1049644066 8:143728302-143728324 CCGGCCCGGCCTCGGCCTCCAGG + Exonic
1049719200 8:144107868-144107890 GGGGCCTGGCCTCGCCCTCCGGG + Intronic
1049798926 8:144508916-144508938 AGGGCGGGGCCGCTGCCTCCCGG - Intergenic
1049798959 8:144509032-144509054 GGGGCGGGGCCACTGCCTCCCGG - Intergenic
1050398166 9:5222368-5222390 TGGGGGCTGCCTCTCACTCCAGG - Intergenic
1053114596 9:35490057-35490079 CGCCGGCGGCCCCTCCCTCCGGG - Intergenic
1057443060 9:95095854-95095876 CAGCCCCGGCCACTCCCTCCCGG - Intergenic
1058967146 9:110048774-110048796 CGGCCGCTGCCTCCCGCTCCGGG - Exonic
1060520773 9:124292709-124292731 GGGGCCAGGCTTCTCCCTCCTGG + Intronic
1060599818 9:124869960-124869982 CGGCCGCCTCCACTCCCTCCTGG - Intronic
1060982688 9:127802872-127802894 GGGGCGGGGCGTCTCCCGCCCGG + Exonic
1061457881 9:130712603-130712625 GGGGCTCGGCCCCGCCCTCCTGG - Intergenic
1061618294 9:131794270-131794292 CGGGCTCGGCCTCCCCCACATGG - Intergenic
1061789111 9:133049230-133049252 CTGCCGCAGCCTCTCCCTACAGG + Intronic
1061856327 9:133443663-133443685 CCGGCGGGGCCTCACCATCCAGG + Intronic
1062380832 9:136285790-136285812 CTGGAGCGGCCTCACCCTTCTGG + Intronic
1062471880 9:136709737-136709759 AGGGCGGGCCATCTCCCTCCTGG + Intergenic
1062494501 9:136825414-136825436 TGGGCACGGCCCCTCCCTCCCGG - Intronic
1062494532 9:136825480-136825502 TGGGCACGGCCCCTCCCTCCAGG - Intronic
1062494548 9:136825513-136825535 TGGGCACGGCCCCTCCCTCCCGG - Intronic
1062567499 9:137169836-137169858 CGGCCACGGCCTCGCCCTCGGGG - Exonic
1062639162 9:137508289-137508311 CGGGCGCGGCAGCTCACGCCTGG + Intronic
1062718605 9:138023385-138023407 CGGCCGCGGCCGCTCCTCCCGGG - Exonic
1185791309 X:2929516-2929538 CGGGCGCGGTGGCTCCCGCCTGG + Intergenic
1186476543 X:9862267-9862289 AGGGAGTGGCCACTCCCTCCAGG + Intronic
1187367703 X:18677970-18677992 GCGCCCCGGCCTCTCCCTCCTGG - Intronic
1189114273 X:38327287-38327309 CGCCCGCGGACCCTCCCTCCCGG + Intronic
1192185541 X:68944445-68944467 GGCGCACTGCCTCTCCCTCCAGG + Intergenic
1197694930 X:129540435-129540457 CGGGAGCGGCGGCTCCATCCAGG - Exonic
1200084826 X:153599007-153599029 CGGGCGCCGGCTGCCCCTCCGGG + Exonic
1200109129 X:153730314-153730336 CGGGCGCGGGGGCTCCCGCCTGG + Intronic