ID: 1141833281

View in Genome Browser
Species Human (GRCh38)
Location 16:86521716-86521738
Sequence TGGGCTGGCCGCAGGTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141833274_1141833281 4 Left 1141833274 16:86521689-86521711 CCAGGGTTGTGTGGGGCTGTCGC 0: 1
1: 0
2: 3
3: 18
4: 128
Right 1141833281 16:86521716-86521738 TGGGCTGGCCGCAGGTCACGGGG 0: 1
1: 0
2: 1
3: 10
4: 141
1141833270_1141833281 16 Left 1141833270 16:86521677-86521699 CCAGCAACAGGACCAGGGTTGTG 0: 1
1: 0
2: 1
3: 16
4: 519
Right 1141833281 16:86521716-86521738 TGGGCTGGCCGCAGGTCACGGGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141833281 Original CRISPR TGGGCTGGCCGCAGGTCACG GGG Intergenic
900114411 1:1022360-1022382 TGGGCTGGCCACAGGTATGGGGG - Exonic
900173353 1:1281257-1281279 TGGCCGGGCCACAGGTAACGAGG - Exonic
900480451 1:2895669-2895691 GCGGCTGCCCGCAGGGCACGAGG + Intergenic
900715606 1:4141582-4141604 GGGGCAGGCCTGAGGTCACGAGG - Intergenic
901021599 1:6258815-6258837 TGGGCGGGGCCAAGGTCACGGGG - Intronic
902807311 1:18869167-18869189 TGTGCTGGCTGCAGGCCACCAGG - Intronic
904419879 1:30384739-30384761 TGGGCTGACCTCAGGGCAGGGGG + Intergenic
906479480 1:46190694-46190716 GGGGCTGGCAGCAGGGCAAGGGG - Intronic
912043754 1:105426615-105426637 TCCGATGGCCGCAGATCACGAGG - Intergenic
915553217 1:156646924-156646946 TGGGCTCTCCGCGGGTCAAGTGG + Exonic
921377923 1:214493128-214493150 TGGGCTGGCTGCAGGGCAGAGGG + Intronic
922466787 1:225849880-225849902 AGGGCTGGCCCCAGGTCAGAAGG + Intronic
922807950 1:228400354-228400376 TGGCCTGGCGGCAGGTCAGGGGG - Intronic
923087204 1:230710745-230710767 TGGCCTGGCTGCAGGTGACCGGG - Exonic
1062908852 10:1199374-1199396 CGGGCAGGCCCCAGGTAACGTGG + Intronic
1063153130 10:3354894-3354916 TGGGCTGGCTGCTGGGCATGGGG + Intergenic
1069133253 10:64732100-64732122 GGGGCTAGCTGCAGGTCACATGG - Intergenic
1070169056 10:73918916-73918938 AGGGCTGGCTCCAGGTCTCGTGG + Intronic
1071545808 10:86528367-86528389 TTGGGTGGCTGCAGGTCAGGTGG - Intergenic
1076474399 10:130742370-130742392 TGTGCTGGCCACAGGGCAGGAGG + Intergenic
1077005277 11:352194-352216 TGGGCAGCCCGCAGCTCTCGGGG - Intergenic
1083148614 11:60776174-60776196 TGGCCTGGCCGCAGGTCTCCTGG + Exonic
1083812544 11:65113611-65113633 TGAGCTGGCCTCAGGCCAGGGGG + Intronic
1083888674 11:65585138-65585160 TGGGCTGGGCGCTGCCCACGCGG - Exonic
1084269117 11:68019734-68019756 TGGGCGGGCCCCAGGAGACGGGG + Exonic
1084327426 11:68409895-68409917 TGGTCTGGCAGCAGGTGAGGAGG - Exonic
1087013858 11:93537955-93537977 TGGTCAGGCCGGAGGTCAGGTGG - Intronic
1091776059 12:3185676-3185698 TGAGCTGGCCGCTGGGCATGTGG + Intronic
1092021470 12:5206210-5206232 TTGGGAGGCCGCAGATCACGAGG - Intergenic
1101952848 12:109189776-109189798 TGTGCTGTCAGCAGGTAACGGGG - Intronic
1104055778 12:125228847-125228869 TGGGCTAGCACCTGGTCACGTGG - Intronic
1104869297 12:131983166-131983188 GGGGCTGGCCCCAGGTTACATGG + Intronic
1104888269 12:132124829-132124851 TGGGCTGGCCTCAGGGAACTTGG - Intronic
1109639055 13:65162958-65162980 TGGGCTGGACCAAGGTCACCTGG + Intergenic
1113967899 13:114164891-114164913 TGTGCTGGCAGCAGGGCAGGCGG - Intergenic
1118473733 14:66098570-66098592 TGGGCTGGAAGCAGATCAAGTGG + Intergenic
1118810068 14:69266795-69266817 TGGGCTGGCCTCAGTGCATGGGG - Intronic
1121211988 14:92214086-92214108 CGGGCTGGCCCCAGGTCAGCTGG - Intergenic
1126792772 15:52236223-52236245 TGGGCTGGCAGCAGGCCCCGTGG + Intronic
1128336193 15:66787179-66787201 TGGGCTGGCCCATGGCCACGGGG - Intergenic
1128384975 15:67141163-67141185 TGGGCTGACCGCAAGTGAGGTGG + Intronic
1128776942 15:70327886-70327908 TGGCCTGGCCTCGGGTCATGTGG + Intergenic
1129356693 15:74996292-74996314 AACGCTGGCCGGAGGTCACGAGG + Intronic
1129672642 15:77615831-77615853 TGGGCTGCCAGCAGGCCAGGAGG + Exonic
1129825387 15:78631426-78631448 TGGGGTGGCAGTTGGTCACGTGG - Intronic
1130143551 15:81253959-81253981 TGGGATGGCCACATGTCATGTGG - Intronic
1130166766 15:81469295-81469317 TGCACTGGCTGCAGATCACGGGG - Intergenic
1131394589 15:92076561-92076583 TGGGCTAGCGGCAGGTCCCTGGG - Intronic
1131689975 15:94816154-94816176 TTAGCTGGCCACAGGTCACTGGG - Intergenic
1132178348 15:99733161-99733183 TGGGCTGGCCCCAGGTGGCTAGG - Intronic
1132514272 16:359107-359129 GGGGCTGGGCGCAGGCGACGTGG - Intergenic
1133337667 16:5016517-5016539 TGGGCTGGGCGCAAGTCAATGGG - Exonic
1136616276 16:31400426-31400448 TGTGCTGCCCGCAGGGCACTGGG - Intronic
1137878565 16:52021815-52021837 GGGACTGGCCGCAGGTGACCAGG - Intronic
1139310625 16:66025121-66025143 TGGGCTGGAGGCTGGTCACCAGG - Intergenic
1141833281 16:86521716-86521738 TGGGCTGGCCGCAGGTCACGGGG + Intergenic
1141920282 16:87131065-87131087 TGGGCTGCCCCCAGGGCACAGGG - Intronic
1143586261 17:7852123-7852145 CGGGGTGGCCACAGGTCAGGTGG - Intronic
1149865344 17:60148429-60148451 GGGGCTGGCCAGAGGTCACAGGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150738395 17:67759826-67759848 TGGGCAGGCAGTAGGTCAGGGGG - Intergenic
1151535474 17:74736852-74736874 TGGGCTGTCCCCAGGTGGCGAGG - Intronic
1152641347 17:81450554-81450576 TGGGCTGAACACAGGTCAGGAGG - Intronic
1154162679 18:11991600-11991622 TGGGCTGGCAGCTGGAGACGCGG + Intronic
1157819473 18:50754906-50754928 TGGGCTGACCCCAGTTCACAAGG + Intergenic
1159493347 18:69167174-69167196 TGGATTGGCGGCAGGTCATGGGG + Intergenic
1160419720 18:78735671-78735693 TGGGCTGGCACCAGCACACGTGG + Intergenic
1160984483 19:1831976-1831998 TGGCCTGGCCACAGGTCCCAGGG - Intronic
1161197336 19:2994105-2994127 TGGGCTGGGGGCAGGACCCGGGG + Intronic
1161242009 19:3227939-3227961 TGGCCTGGCCGAAGGTGGCGTGG + Intronic
1161594444 19:5144050-5144072 CGGCGTGGGCGCAGGTCACGTGG - Exonic
1162443452 19:10707578-10707600 TGGGCTGGACGCAGATCTCCGGG + Exonic
1164649682 19:29882844-29882866 AGGGCTGGGGGCAGGCCACGAGG - Intergenic
1165742797 19:38213603-38213625 GGGGCGGGCAGCAGGGCACGCGG + Intronic
1166702151 19:44888448-44888470 TGGCCTGGCCAGAGGTCAGGGGG - Exonic
1168722587 19:58562360-58562382 TGGGCTTCACGCAGGTCTCGCGG - Exonic
934553484 2:95275906-95275928 TGGGCAGGCAGCAGGGCATGAGG - Intronic
937380110 2:121368629-121368651 TGGGCTGGCTGCTGGCAACGGGG + Intronic
937854823 2:126664686-126664708 TGGGCTGAGCTCAGGTCACAGGG - Intronic
937905829 2:127052359-127052381 TGGGCTGGTAACAGGCCACGAGG + Exonic
947462218 2:230313444-230313466 GGGGCTGGCCTCAGGCCACGGGG - Intergenic
947471339 2:230403955-230403977 GGGGCCGGCCTCAGGCCACGGGG - Intergenic
948640885 2:239375412-239375434 TGGGCTGGCCGTGGGCCACCAGG - Intronic
948958642 2:241315249-241315271 TTGGCTGCGCGCACGTCACGTGG - Intronic
1171169692 20:23004650-23004672 TGGTGCTGCCGCAGGTCACGTGG - Intergenic
1174552698 20:51373188-51373210 CGGGATGGCCGCAGGGCTCGGGG + Intergenic
1175902894 20:62366963-62366985 TGGGGTCGCCGCCGGCCACGGGG + Exonic
1175933426 20:62504095-62504117 TGGGCTGGCTGCGGGGCAGGTGG - Intergenic
1176097026 20:63349014-63349036 TGGGCTGGCCCCGGGCCCCGGGG + Intronic
1176238332 20:64064455-64064477 GGGTCTGGCCGCAGGTCATTTGG + Intronic
1176272011 20:64240209-64240231 TGGGCTTGTCTCAGGTCACGTGG + Intronic
1177968293 21:27757279-27757301 TTAGCTGGCCGCAGCTCACCAGG + Intergenic
1180048166 21:45319156-45319178 TGTGCAGGCAGCAGGTCAGGTGG + Intergenic
1180959659 22:19756874-19756896 TGGGGTGGCGGCAGGTGAAGAGG + Intronic
1181085237 22:20436754-20436776 TGGGCTGGCCAAAGGCCACAAGG - Intronic
1184730765 22:46369839-46369861 TGGGGTGGCCACTGGGCACGTGG - Intronic
1185258371 22:49848914-49848936 TGGGGTGGCCGCAGCCCGCGGGG - Intergenic
1185332548 22:50258207-50258229 TGGGCTGGCCGCTGGGCACGAGG - Intronic
1185371738 22:50464177-50464199 TGGGCTGGCCGGAGGGTAGGTGG - Intronic
952906225 3:38140723-38140745 TGGGCAGGCTGCAGGTCCTGTGG - Intronic
953548699 3:43883899-43883921 TGGGCTGGCAGCAAGTCCCTGGG + Intergenic
954439415 3:50513479-50513501 AGGGCTTGCCCCAGGTCACTGGG + Intergenic
960281332 3:115784310-115784332 TGCGCGGGCCGCAGGGCAGGAGG + Intergenic
960989202 3:123299917-123299939 TGGAGTGGCCTCAGGTCACCAGG - Intronic
961695140 3:128698858-128698880 AGGGCTGGCCGCAGGCTGCGGGG + Intergenic
961795152 3:129403769-129403791 AGGGCTGGAGGCAGGTCCCGGGG + Intronic
964414017 3:156428761-156428783 TGGGCTGTTCGCAGGTCAAGAGG + Intronic
964414091 3:156429382-156429404 AGGGCTGGCCTCAGGGCAGGTGG + Intronic
968544582 4:1192237-1192259 TTGGCTGGCTGTGGGTCACGAGG - Intronic
973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG + Intronic
973818970 4:54645852-54645874 TGGGCTGACCTCAGGTGACCAGG - Intergenic
982136705 4:152279509-152279531 TGGGCTGGCCTTAGGTGACCTGG - Intergenic
983640721 4:169941927-169941949 TGGGCTGGCTCCAGGCCACATGG - Intergenic
985549637 5:526452-526474 TGGGGTGGCCGGAGGTCCAGTGG - Intergenic
986507257 5:8464974-8464996 TGGGCTGTCAGCAGGTAACTTGG - Intergenic
986932634 5:12845834-12845856 TGAGCTGGCTGCAGTTCACAGGG + Intergenic
991976029 5:72184304-72184326 TGGGCTGGCACCAGGTCACCTGG + Intronic
999248324 5:150167115-150167137 TGGGCTGGCGGCAGGGGCCGCGG - Exonic
1002046175 5:176542995-176543017 TGCGCGGGGCGCAGGGCACGCGG + Intronic
1003161486 6:3638225-3638247 TGGGCTGGGAGCAGGGCAGGGGG + Intergenic
1006935148 6:37712094-37712116 TGGGCTGGCACCAGCTCACCAGG - Intergenic
1010083319 6:71887527-71887549 TGGGCTGGGAGCAGGTTAGGGGG + Intronic
1017765169 6:157601065-157601087 TGCCCTGGCCGCAGCGCACGGGG + Intronic
1017788704 6:157776687-157776709 TGGGGTGGCCCCAGGTCCCATGG + Intronic
1019329468 7:455488-455510 TGGGCTGGACGCAGGACGTGGGG + Intergenic
1020079955 7:5282002-5282024 TGGGTCAGCCGCAGGTCACCCGG + Intronic
1020096862 7:5374334-5374356 TGGCCTGGCCGCCGGCCCCGCGG - Exonic
1021451479 7:20786500-20786522 TGGGCTGGACGCAGGTCTCCCGG + Intronic
1022181939 7:27929267-27929289 TGGGCATGCCACAGGCCACGGGG - Intronic
1025198958 7:56950214-56950236 TGGGTCAGCCGCAGGTCACCTGG - Intergenic
1025672988 7:63626719-63626741 TGGGTCAGCCGCAGGTCACCTGG + Intergenic
1026904802 7:74056813-74056835 TGGCCTGGACCAAGGTCACGAGG + Intronic
1030298357 7:107951314-107951336 TGTTCTGGCCGCAGTTCACGGGG - Exonic
1040304636 8:46205695-46205717 TGGGCTGGTCGCAGGGCTCAGGG + Intergenic
1040305685 8:46210610-46210632 TGGGCTGGCCGCAGGCCTGAGGG + Intergenic
1041224091 8:55681277-55681299 TGTGCAGTCCGCAGGTCAAGGGG + Intergenic
1049328523 8:142037614-142037636 TGTGCTGGCCTCATGTCAGGAGG - Intergenic
1049434520 8:142580190-142580212 TGGGCTGGCCACAGGGCAAGGGG - Intergenic
1049610589 8:143553087-143553109 TGGCCTGGCAGCAGCTCCCGAGG - Intergenic
1049625368 8:143617465-143617487 GGGGCTGGACGCAGGTGAGGTGG - Exonic
1055876535 9:80949578-80949600 TAGACTGGCCGCATGTCAAGTGG - Intergenic
1056792579 9:89635650-89635672 TGGGCTGGCTGCTGTTCAAGTGG - Intergenic
1061889241 9:133609046-133609068 CGAGCGGGCCGCGGGTCACGGGG - Intergenic
1062235101 9:135504077-135504099 TGGGCTGGCCCCTGGTCCCCGGG - Exonic
1062285835 9:135772099-135772121 GGGCCTGGCCGCAGGGCACTGGG + Intronic
1062290021 9:135790254-135790276 TGGGGTGGCCGCATGGCAGGTGG - Intronic
1185462111 X:338243-338265 TGGGCAGGCTGCAGGGCCCGTGG - Intronic
1187114409 X:16334434-16334456 TGGGGAGCCAGCAGGTCACGTGG + Intergenic
1190913682 X:54794217-54794239 TGGTCTGGCAGCAGGACACTGGG + Intronic
1193185578 X:78508034-78508056 TTGGCTGGCCTCAAGTCAGGAGG - Intergenic
1199757941 X:150882219-150882241 TGGGATGGCTGAAGGGCACGTGG - Intronic
1200099857 X:153685027-153685049 TGGGCTGGGCACAGGTCGCAGGG + Intronic
1200147867 X:153935657-153935679 TGGGTTGACCCCAGGTGACGTGG + Intronic