ID: 1141837204

View in Genome Browser
Species Human (GRCh38)
Location 16:86549636-86549658
Sequence GTGATTCTAATGCACACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 2, 1: 2, 2: 12, 3: 77, 4: 360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141837204_1141837206 2 Left 1141837204 16:86549636-86549658 CCTTTAGTGTGCATTAGAATCAC 0: 2
1: 2
2: 12
3: 77
4: 360
Right 1141837206 16:86549661-86549683 GCAAGCTTTAAGAATTACCGAGG 0: 1
1: 0
2: 0
3: 3
4: 66
1141837204_1141837208 26 Left 1141837204 16:86549636-86549658 CCTTTAGTGTGCATTAGAATCAC 0: 2
1: 2
2: 12
3: 77
4: 360
Right 1141837208 16:86549685-86549707 CTAGACCTCACTCCAGAGACTGG 0: 1
1: 0
2: 4
3: 15
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141837204 Original CRISPR GTGATTCTAATGCACACTAA AGG (reversed) Intronic
901682120 1:10919272-10919294 GTGATTCTAATGGGCAACAAGGG + Intergenic
902986565 1:20157971-20157993 GTGACTTTAATGCATACCAAAGG + Intergenic
903362986 1:22788598-22788620 GTGACTCTGATCCACAATAAAGG - Intronic
908570369 1:65403642-65403664 GTAATTCTAATGCACAATCAAGG + Intronic
910881524 1:91925974-91925996 GTGATTGTTATGATCACTAAAGG - Intergenic
911077287 1:93889438-93889460 GTGATTCTAATGTATAGTCAGGG + Intronic
911361177 1:96878466-96878488 GTCAAACTAATGCAAACTAAAGG - Intergenic
911376912 1:97062262-97062284 GTGATTATAATTCAAACTGAAGG + Intergenic
911847030 1:102766781-102766803 GTAATTGTAATGCACGCTCAAGG + Intergenic
914335552 1:146711949-146711971 GTGATTCTAATGTGCATTCATGG - Intergenic
917364781 1:174218245-174218267 GTGATTCCAAGTCACTCTAAAGG - Intronic
917617431 1:176760566-176760588 GTGAGTCTAATGCACAGCTATGG + Intronic
917640185 1:176975857-176975879 ATGATTCTAAAGCACACAATAGG + Intronic
917854090 1:179087696-179087718 GTGATTCTCAAGCACCCTGAGGG - Intronic
918224686 1:182470974-182470996 TGGATTAAAATGCACACTAAGGG + Intronic
919589143 1:199477920-199477942 CTAATTTTAATGAACACTAACGG + Intergenic
919758843 1:201084153-201084175 ATGAATATAATACACACTAAAGG - Intronic
920248817 1:204608503-204608525 GTGATTCTAATGCACAGCCAAGG + Intergenic
920611318 1:207440548-207440570 GTGATTCTAATGTACAGTCAGGG - Intergenic
921025193 1:211272498-211272520 GTGATTCCAATGCACACCCAGGG - Intronic
921548361 1:216501369-216501391 TTAATTCTAAAGCACATTAATGG + Intergenic
921660347 1:217793648-217793670 GTGATTCAAATGCACAGTTCTGG + Intronic
922540042 1:226411933-226411955 GAGATTCTAATGCACCCGAAAGG - Intergenic
923124157 1:231021007-231021029 GTGGTTCTCATGCACTTTAAAGG - Intronic
923191253 1:231622906-231622928 GTGATTCTAAAGCACAGTGAGGG - Intronic
923584891 1:235259713-235259735 GTGATTCTAATTTACACTCCTGG - Intronic
923647679 1:235840604-235840626 GTGATTCTAATGAACAGTCAGGG + Intronic
924645803 1:245876388-245876410 GTGATTCCAATGCACAGTCTGGG + Intronic
1063858510 10:10282450-10282472 GTGATCCTAATACCCACTGAAGG - Intergenic
1063947629 10:11192751-11192773 GTGATTCTAACGCACGCCAGGGG - Intronic
1064226846 10:13494088-13494110 GTGATTCTAATGTACAACCAAGG - Intronic
1064397289 10:14992151-14992173 GTGACTTTAATGAACACTAAAGG - Intergenic
1064400184 10:15014611-15014633 GTGACTTTAATGAATACTAAAGG - Intergenic
1064460417 10:15529651-15529673 ATGATTCTGATGCATACTCAGGG + Intronic
1064636375 10:17371985-17372007 GTGAGTCTAATGCACTCTCCAGG + Intronic
1066390339 10:34973008-34973030 GTGACTTTAATGAATACTAAAGG + Intergenic
1066822045 10:39507487-39507509 GTGAGTTTAATGCACACATAAGG - Intergenic
1067337983 10:45379664-45379686 GTGGTTCTGATGCACACAACCGG + Intronic
1068243005 10:54329163-54329185 GGAATTCTAAGGTACACTAAAGG - Intronic
1069058111 10:63865754-63865776 GTGATTCTGATGTGCACCAAAGG - Intergenic
1071015342 10:80990295-80990317 GTGTCTCTAATGCACACTCTAGG - Intergenic
1071094896 10:81962074-81962096 GTGATTCTGATGAGCACTAAAGG + Intronic
1071110365 10:82148567-82148589 GTGATTTTGATGCACACGTATGG - Intronic
1071518905 10:86316890-86316912 GTGATTCTTGTGCACACTCAGGG - Intronic
1071780588 10:88839962-88839984 GTGATTCTGATGCACAGTGAGGG + Intronic
1072523765 10:96253682-96253704 GTGACTCTTATGCACACAGAAGG + Intronic
1073825976 10:107321957-107321979 GTGATTCTAAGACATACTAGAGG + Intergenic
1074538923 10:114348840-114348862 GTGAGTCTAATGCACAGCCAAGG + Intronic
1075185727 10:120255109-120255131 CAGATTCTAATGCATACTGAAGG + Intergenic
1075579066 10:123603246-123603268 GTGATTCACATGCACACTAAAGG + Intergenic
1077589087 11:3478004-3478026 GTGACTTTAATGAATACTAAAGG - Intergenic
1077790451 11:5434060-5434082 GTGATTCTGATGCATAGCAAAGG - Intronic
1078391197 11:10937017-10937039 GTAATTCTGATGCACAGTGAGGG - Intergenic
1078449369 11:11428716-11428738 GTGATTCTAATATGCACTCAGGG + Intronic
1078630613 11:13000515-13000537 GGGATTCTTATGCACACTAAAGG - Intergenic
1079786889 11:24684532-24684554 ATGATTCAAATGCACGCTGATGG + Intronic
1080854453 11:36100171-36100193 GTGATTCTAATGCACACTGAAGG + Intronic
1082960628 11:58915661-58915683 GTGATTCTGATGCAGAATGATGG + Intronic
1083113357 11:60434222-60434244 GTGATTCTAATGTACATATAGGG - Intronic
1083246648 11:61433595-61433617 GAGATTCTGATGCAGACTGAAGG - Intronic
1083288721 11:61678004-61678026 GTGATTTGAATGCACATGAAAGG - Intergenic
1084227778 11:67728128-67728150 GTGACTTTAATGAATACTAAAGG - Intergenic
1084244781 11:67849627-67849649 GTGACTTTAATGAATACTAAAGG - Intergenic
1084807451 11:71588738-71588760 GTGACTTTAATGAATACTAAAGG + Intronic
1084811473 11:71614287-71614309 GTGACTTTAATGAATACTAAAGG + Intergenic
1084827904 11:71744929-71744951 GTGATTTTAATGAATACTAAAGG + Intergenic
1084844539 11:71888746-71888768 GTGACTTTAATGAATACTAAAGG + Intronic
1084847394 11:71911202-71911224 GTGACTTTAATGAATACTAAAGG + Intronic
1085783306 11:79429028-79429050 GTGATTCTAATGCACCGCCAGGG + Intronic
1088029410 11:105228122-105228144 CTGGTTCTAATTCACACAAATGG + Intergenic
1088861293 11:113802117-113802139 ATGATTCTGATGCACACTAGGGG + Intronic
1089182528 11:116592987-116593009 GTGATTCTAAAGTACAATCAGGG + Intergenic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1091661309 12:2385776-2385798 GTGATTCTAATATACACCCAGGG - Intronic
1092415349 12:8286772-8286794 GTGACTTTAATGAATACTAAAGG - Intergenic
1092432455 12:8420378-8420400 GTGACTTTAATGAACACTAAAGG - Intergenic
1092750401 12:11713776-11713798 GTGATTCTAATGAACATCCAAGG - Intronic
1094537916 12:31338478-31338500 TTGATGCTGATGCACACTAAGGG + Intergenic
1094690937 12:32768062-32768084 GTGATTCTAATGCACTTTACAGG + Intergenic
1095578870 12:43771816-43771838 GTGATTCTTATGCATGATAAAGG - Intronic
1096719821 12:53512873-53512895 GTGATTCTAATGCACACTAAAGG - Exonic
1098147976 12:67517053-67517075 GTGATTCTAATGTACAGCCAAGG - Intergenic
1098528367 12:71512441-71512463 GCGATTCTAATGCATATTCAAGG - Intronic
1098975864 12:76901472-76901494 GTAATTCTAATCCCCACTTATGG + Intergenic
1099237937 12:80104352-80104374 GTGATTCTAATGAGCAATAAGGG - Intergenic
1099372370 12:81851810-81851832 ATGATACTAATGCAAAATAAAGG - Intergenic
1099655747 12:85488209-85488231 GTGTTTCTAAAGCACAATACTGG + Intergenic
1100780864 12:98024800-98024822 GTGATTCTAATGGGCAGTGAAGG - Intergenic
1101400033 12:104379232-104379254 CTGATTCTGATGCCCACTCAAGG - Intergenic
1101670626 12:106868921-106868943 GTGATTCTAATGTACAGCCAAGG + Intronic
1101900143 12:108785951-108785973 GTGATTTTAATTGACACTAGTGG + Exonic
1103435408 12:120921571-120921593 GTGATTCTAATGTCCAGTCAGGG + Intergenic
1103467432 12:121153080-121153102 GTGATTCTAATGCATAGCCAGGG - Intronic
1104589826 12:130075359-130075381 TTCATTCACATGCACACTAAAGG - Intergenic
1104617604 12:130283587-130283609 GTGGTTCTAATGAACATCAAAGG + Intergenic
1106440935 13:29769483-29769505 GTGATTTTTATGTACGCTAAAGG - Intronic
1107351636 13:39520794-39520816 GTGATTCTAATGTGCAGTCAGGG - Intronic
1107693126 13:42972251-42972273 GTGATTATGATGCACGATAAAGG - Intronic
1109766380 13:66905384-66905406 GTGATTCTAATATACAGTCAGGG - Intronic
1110525855 13:76536191-76536213 ATGATTCTGATGCATGCTAAAGG - Intergenic
1110652434 13:77958104-77958126 GTGATTCTAATATAGAGTAATGG - Intergenic
1111346530 13:86963425-86963447 GTAATTATAAGGCACAGTAATGG + Intergenic
1112088392 13:96054567-96054589 GTGATTCCTATGCACAGGAAAGG + Intergenic
1113188518 13:107717435-107717457 ATGATCCTGATGCACACTGAAGG + Intronic
1113252608 13:108471102-108471124 GTGATTCATATGCACATGAAAGG + Intergenic
1115339912 14:32282549-32282571 GTGATGATAATGACCACTAATGG + Intergenic
1116805986 14:49494349-49494371 GTGATTCTATTTCCCAGTAAAGG + Intergenic
1117006720 14:51428212-51428234 GTGATTCTAATGCATAGTCAGGG - Intergenic
1117038742 14:51751310-51751332 GTGACTTTAATGAATACTAAAGG + Intergenic
1117182997 14:53211962-53211984 GTAATTCTAATGCACAGCCAGGG - Intergenic
1117903475 14:60560226-60560248 GTGATTCCAATGCAAGTTAATGG + Intergenic
1118848131 14:69563689-69563711 GTGATTCTGATGTAAACTTAAGG - Intergenic
1118882485 14:69841317-69841339 GTGATTCTAATGCACAGCCATGG - Intergenic
1119018787 14:71087522-71087544 GTGATTCTAATACATGCTAAAGG - Intronic
1119595972 14:75934212-75934234 GTGATTCCAGTGCACACCCAAGG + Intronic
1120689333 14:87575529-87575551 GTGATTTCAAAGGACACTAATGG - Intergenic
1121178435 14:91908676-91908698 GTGATTCAAATGTACAGTCAAGG - Intronic
1122678221 14:103435205-103435227 ATGTTTCTAATGCACAAGAAGGG - Intronic
1127041047 15:54977173-54977195 GTCATTCTAATGTACATTCATGG - Intergenic
1127048932 15:55059607-55059629 TAGATTTTAATGCACATTAAGGG - Intergenic
1127686508 15:61350796-61350818 ATGATTCTGATGCATCCTAAGGG - Intergenic
1127825590 15:62699889-62699911 GTGATTCTAATGGCCAGTCAGGG + Intronic
1128860850 15:71070712-71070734 GTGATTCTAATGGGCAACAAAGG - Intergenic
1128972463 15:72119252-72119274 GTGATTCAAATGCACATACAAGG - Intronic
1130050841 15:80482360-80482382 GTGATTTTGATGCACAGGAAGGG + Intronic
1130828218 15:87571588-87571610 TTTTTTCTAATGTACACTAATGG - Intergenic
1131200652 15:90393073-90393095 GTGATTCTAATGCACACACCTGG - Intronic
1133323208 16:4927456-4927478 GTGATTCTAATGTACAGCCAGGG + Intronic
1133881372 16:9785733-9785755 GTGATTCTAATACACATTAAGGG - Intronic
1134365461 16:13573199-13573221 GTGATTCCAATGTACAATCAGGG + Intergenic
1135126017 16:19809952-19809974 GTGTTTCTAATGTACAGTCAAGG - Intronic
1135920931 16:26648297-26648319 GTGTTGCTAATGCAACCTAATGG - Intergenic
1135984588 16:27174694-27174716 GTGATTCAAATGCGCAGTCACGG + Intergenic
1136098007 16:27972813-27972835 GTGATTCCAATGTACACTCAGGG + Intronic
1136663703 16:31789642-31789664 GTGATTCATATGCACATTAATGG - Intronic
1137850573 16:51738003-51738025 GTGATTCTGGTGCACAGTGAGGG - Intergenic
1138466566 16:57196587-57196609 GTGATTCTAATGCCGTCTATGGG + Intronic
1138910284 16:61388434-61388456 GTGGTTTTAATGCACACTGGTGG - Intergenic
1138959503 16:62011638-62011660 GTCATTCTTATGCACATTAAAGG - Intronic
1139015828 16:62687584-62687606 GTCATTCTACTCCACACTAGTGG + Intergenic
1139084566 16:63568882-63568904 GTGATTATAATGCAAACCCAAGG - Intergenic
1139998074 16:70999279-70999301 GTGATTCTAATGTGCATTCATGG + Intronic
1140487040 16:75301693-75301715 GTGATTCTCATGCACAGCCAAGG - Intronic
1141087639 16:81108293-81108315 GTGATTCTAAGGTGCACTCAGGG + Intergenic
1141390545 16:83659525-83659547 GTGATTCTAATGAACAGCCAAGG - Intronic
1141593440 16:85083407-85083429 GTGTTTCTTATGCAGACTTACGG + Intronic
1141837204 16:86549636-86549658 GTGATTCTAATGCACACTAAAGG - Intronic
1144462172 17:15467125-15467147 GTGATTCTATTGTACACTCAGGG - Intronic
1148587619 17:48791963-48791985 ATGCTTCTAATGAACACCAAAGG - Intronic
1148839022 17:50482900-50482922 GAGATTCTCATACACACTAAAGG - Intronic
1149071397 17:52547685-52547707 GTGACTGTATTGCACACTCAAGG + Intergenic
1149396911 17:56254640-56254662 GTGATTCTGATGTGCACTAGGGG - Intronic
1151011738 17:70506172-70506194 GAGATTCTTATGCACATTGAGGG + Intergenic
1151168387 17:72224371-72224393 GTGTTTCTAATGCACAATTAGGG - Intergenic
1151883723 17:76911183-76911205 GTGATTCTAATGGGCACCAAAGG + Intronic
1152056400 17:78031221-78031243 GTGATTGTGATGCAAACCAAGGG + Intronic
1153265728 18:3267082-3267104 GTGATTTCAATGCACATTGAAGG - Intronic
1153696456 18:7647759-7647781 GTGATTCTGATGCACTGTAATGG - Intronic
1155027640 18:21956974-21956996 GTGATTCTAATGAAAACCCAAGG - Intergenic
1155622606 18:27796702-27796724 ATGATTCTTATGCACATTAAAGG - Intergenic
1156206275 18:34889386-34889408 GTGATTCTGATGCTCGCTAAAGG + Intronic
1156820787 18:41370675-41370697 GTGGTTCAAATGAACACCAAAGG - Intergenic
1156847384 18:41682309-41682331 GTGATTCTAATGTACAACCAAGG + Intergenic
1158022550 18:52860380-52860402 GTGATTCTAAGGCAGAAAAATGG + Intronic
1158163823 18:54516888-54516910 TTGATTCTAATGCACAGCCAAGG + Intergenic
1158901292 18:61964197-61964219 GTGTTTTAAATGCAAACTAATGG - Intergenic
1160147002 18:76373390-76373412 GTGTTTCTAATGCAAATGAATGG - Intronic
1160391836 18:78539823-78539845 CTGAGCCTAATGCACACAAATGG + Intergenic
1162120285 19:8461647-8461669 ATGATTCTAATCTACACAAAAGG - Intronic
1163989643 19:20986631-20986653 GTGATTCACATGCACATTAATGG + Intergenic
1164208387 19:23076194-23076216 GTGTCTCTAATGTACAATAAAGG - Intronic
1164879770 19:31722123-31722145 GTGATTCTAATGCAGAGGCAGGG + Intergenic
1166723083 19:45008806-45008828 GTGATTCTAAGGCTCACTGGCGG + Intronic
926671171 2:15578201-15578223 GTGATTCTGGTGCACACTGAAGG + Intergenic
926786767 2:16525642-16525664 GTGATTCTTATGGGCACTCAGGG + Intergenic
926857821 2:17276065-17276087 GTGACTCTGATGCACATTACAGG + Intergenic
926976948 2:18524998-18525020 GTGATTCTAATGCTCAGTGAAGG + Intergenic
927265617 2:21146051-21146073 GTGATTCTAATGCACAGCTAAGG + Intergenic
927381924 2:22489244-22489266 GTGATTTTAGTGCTCACTATGGG + Intergenic
928263566 2:29789714-29789736 GTGATTCTAATGAATAATCATGG - Intronic
928912269 2:36433697-36433719 GTGATTTTAATGCACAGCCAGGG + Intronic
930594773 2:53373539-53373561 GTTATTTTAATGAACACGAAAGG + Intergenic
931633096 2:64318825-64318847 ATGATTCTAATGCACAGCTATGG + Intergenic
931794762 2:65698729-65698751 GAGATTCTAATGCACAGACAAGG + Intergenic
931968806 2:67563318-67563340 GTGATTCTAAGGCACAGCCAAGG + Intergenic
932353380 2:71049254-71049276 GTGACTTTAATGAACACTAAAGG + Intergenic
933243659 2:79951306-79951328 GTGATTCTAATGTACAGCCAGGG + Intronic
933823424 2:86136340-86136362 GTGATTCTCATGTACACACAGGG + Intronic
935164888 2:100561910-100561932 GTGATTCTAATGCATAGCCACGG + Intergenic
936368523 2:111883549-111883571 GAGACCCAAATGCACACTAACGG + Intronic
938670540 2:133582311-133582333 GTGATTCTGATGGATGCTAAAGG + Intergenic
938810281 2:134846375-134846397 GTGATTCTGATGCACTGTCAAGG + Intronic
938867560 2:135438911-135438933 GTGATTCAAATGCACAATCAAGG + Intronic
938922766 2:136010031-136010053 GTGATTCTAATGGATACCGAGGG + Intergenic
940129478 2:150364755-150364777 GTGATTCTAATGCGCAGCCAGGG - Intergenic
940724531 2:157321233-157321255 GAAATTCTCATGCCCACTAAAGG - Exonic
940839888 2:158568003-158568025 GAGATTCTCATGCACACGGAAGG - Intronic
940869457 2:158847902-158847924 GTGACTTTAATGAATACTAAAGG + Intronic
940872132 2:158868899-158868921 GTGACTTTAATGAATACTAAAGG + Intergenic
940874344 2:158884900-158884922 GTGACTTTAATGAATACTAAAGG + Intergenic
941083357 2:161088336-161088358 GTGATTCTAATGGACAGCCAAGG - Intergenic
941760414 2:169235864-169235886 GTGATTATAATGGACACCATCGG - Exonic
941849387 2:170163856-170163878 GTGATTCCAATGTACAGTCAGGG + Intergenic
941952966 2:171175815-171175837 GTGATTCTAATGTGCAGTCAAGG - Intronic
942398412 2:175576316-175576338 GTGATGCTAATGCACAGCCAGGG - Intergenic
942552105 2:177130384-177130406 GTGATTCTGATGCCCAGTGAAGG - Intergenic
942688702 2:178562415-178562437 GTGGTTGAAATGCAGACTAAAGG - Exonic
942916064 2:181308592-181308614 GTGATTCTAATGTTCAGTCAAGG + Intergenic
943041772 2:182812780-182812802 GTGATTCTAATATACAGTGAGGG - Intergenic
943173268 2:184432313-184432335 GTGATTCTAATGCATAGACAAGG - Intergenic
943433227 2:187830192-187830214 GTGATTCTAATGGAGACCAAGGG + Intergenic
943586086 2:189742129-189742151 GTGATTCTGATATACCCTAAAGG - Intronic
943684505 2:190803827-190803849 GTAATTCTGATGCACACCAGTGG - Intergenic
943964730 2:194319203-194319225 CTTATTCTAGTGCACACTACTGG + Intergenic
944934130 2:204549609-204549631 GTGATTCTAATGCCCAGCCAAGG + Intronic
945350081 2:208767072-208767094 GGGATTCTAATGCACCCTGAAGG + Intronic
945470486 2:210223497-210223519 GTGATTCCTTTGCACATTAAAGG + Intronic
946774262 2:223121180-223121202 GTGATTTTAATGTACAGTCAAGG - Intronic
947253324 2:228133967-228133989 GTGAACCTAATGCACATGAAAGG + Intronic
1169302362 20:4455287-4455309 GTGATTCTAATGCACAGCCAGGG - Intergenic
1169502726 20:6176775-6176797 GTGATTCTAATGGATTCTAATGG - Intergenic
1169513578 20:6292519-6292541 GTGATTCTAGTCAACACTAAAGG - Intergenic
1169979903 20:11372675-11372697 GTGAATCTAATGTGCACTTAAGG + Intergenic
1170092828 20:12610345-12610367 GTGATTCTAATGTGCATTTAAGG - Intergenic
1170198155 20:13712161-13712183 GTGATTCTAATAAACAGAAAAGG + Intergenic
1170418154 20:16166503-16166525 GTGATTCTAATTGACTCTAAGGG - Intergenic
1170694780 20:18648273-18648295 GTGATTCTAATGCACATTCAAGG - Intronic
1170826029 20:19796641-19796663 GTGATTCCAATGTGCACTGAAGG - Intergenic
1170942575 20:20861042-20861064 GTAATTCTAAGCAACACTAATGG + Intergenic
1170980143 20:21204944-21204966 GTGATTCTAAAGCACAACAATGG - Intronic
1172631733 20:36383119-36383141 GTGCTTCTAAAGCAGCCTAAGGG - Intronic
1172672910 20:36646565-36646587 GTGATTCCTATACACATTAAAGG - Intergenic
1172998865 20:39091377-39091399 GTAATTAATATGCACACTAAAGG + Intergenic
1173036983 20:39421408-39421430 GTGATTGTAATGCACAGCCAGGG + Intergenic
1173246179 20:41339411-41339433 GTGATTCTAACACACAGTCAAGG + Intergenic
1175192885 20:57223412-57223434 GTGATTCTATTGCACAGCCAAGG + Intronic
1176953280 21:15070881-15070903 GTGATGCTACTTCACACTCAAGG + Intergenic
1178029646 21:28509645-28509667 AAGATTCTAATGCACAGTCAGGG - Intergenic
1178503422 21:33144404-33144426 GTGATTCTGATGCGCAGTTAGGG - Intergenic
1179053132 21:37906465-37906487 GGGATTCTGATGCACTCTAAAGG - Intronic
1181547962 22:23614459-23614481 GTAAGTAAAATGCACACTAAGGG + Intronic
949884486 3:8682484-8682506 GTGACTTTAATGAATACTAAAGG + Intronic
949893899 3:8754793-8754815 GTAATTCTAATGCACCCTCAAGG + Intronic
950121925 3:10487721-10487743 GTGATTCCCATGAACATTAACGG - Intronic
951149323 3:19268792-19268814 GTGATTCTGATGCTCACTAAAGG + Intronic
951162127 3:19436908-19436930 GTGTTTCTGATGCAAGCTAAAGG + Intronic
952614825 3:35258186-35258208 GTGATTCTGATGCACAGTGTGGG - Intergenic
955803603 3:62710651-62710673 GTGATTCTGATGCACAGCTAGGG + Intronic
956050918 3:65247624-65247646 GTGATTCTGATGCATACTGAAGG - Intergenic
956725355 3:72152378-72152400 GTGATTCCTCTGCACACTACGGG - Intergenic
957044460 3:75363193-75363215 GTGACTTTAATGAATACTAAAGG - Intergenic
957076252 3:75605377-75605399 GTGACTTTAATGAATACTAAAGG - Intergenic
959565781 3:107831596-107831618 GTGATTCTAATGTGCAATTAGGG + Intergenic
959646827 3:108712839-108712861 GTGATTCTAATGCTCCCCATGGG - Intergenic
959793474 3:110393401-110393423 GTGCTGCTAATACACAATAATGG - Intergenic
959867285 3:111285450-111285472 GTGATTTTAGTGCACAGTCAGGG + Intergenic
960176469 3:114523589-114523611 GAGATTCTAAGGCACAATGAGGG + Intronic
960617729 3:119611762-119611784 ATGATTCTAGAGCACCCTAAAGG - Intronic
960790361 3:121423587-121423609 GTGATTCTTATGTACAGTCAAGG - Exonic
961272191 3:125697569-125697591 GTGACTTTAATGAATACTAAAGG + Intergenic
961275050 3:125719802-125719824 GTGACTTTAATGAATACTAAAGG + Intergenic
961277968 3:125742433-125742455 GTGACTTTAATGAATACTAAAGG + Intergenic
961876454 3:130027229-130027251 GTGACTTTAATGAATACTAAAGG - Intergenic
961892895 3:130145386-130145408 GTGACTTTAATGAATACTAAAGG - Intergenic
963707312 3:148703373-148703395 GTGATTCAAATGCACATTAAGGG + Intronic
963719837 3:148849724-148849746 GTGCTTCTAATGCAGAGAAATGG - Intronic
963839428 3:150090580-150090602 GTGATTCTGATGCACTGTGAGGG + Intergenic
964339623 3:155694353-155694375 GTGATTCCAATGCACAGCCAAGG + Intronic
965633868 3:170761064-170761086 GTGGTTTTATTGCACTCTAAGGG + Intronic
966903587 3:184505756-184505778 GTGATTCTAATGGGCACCCATGG - Intronic
967020447 3:185517766-185517788 GTGATTCTAAAGCACAATCAAGG + Intronic
967130795 3:186469067-186469089 GTGATTCTAATGTATAATGAGGG + Intergenic
967585028 3:191202813-191202835 TTAATTCTAATGCTCACTAAAGG - Intronic
967613555 3:191537479-191537501 GTGATTCTAATGTGCATTCAGGG - Intergenic
967935046 3:194720421-194720443 GTGATTCTAATGTACAATCGGGG + Intergenic
968988724 4:3894434-3894456 GTGACTTTAATGAATACTAAAGG - Intergenic
969024410 4:4162078-4162100 GTGACTTTAATGAATACTAAAGG - Intergenic
969025313 4:4168024-4168046 GTGACTTTAATGAATACTAAAGG - Intergenic
969067145 4:4494993-4495015 ATGATTCTAATGTACAATCAGGG + Intronic
969734157 4:8975735-8975757 GTGACTTTAATGAATACTAAAGG + Intergenic
969749862 4:9101755-9101777 GTGACTTTAATGAATACTAAAGG + Intergenic
969793738 4:9509794-9509816 GTGACTTTAATGAATACTAAAGG + Intergenic
970850953 4:20602530-20602552 GTGATTCCAATGCAGACTTTTGG - Intronic
970878059 4:20895767-20895789 GTGATTCTAATGAGCAATCATGG - Intronic
972332857 4:38079948-38079970 GAAATTCTAATGCACACAAAAGG - Intronic
973268043 4:48231028-48231050 TAGATTCTAATACACACTTAAGG - Intronic
973888725 4:55347815-55347837 GTCATTCTGAGGCACCCTAAAGG + Intronic
974606091 4:64152786-64152808 ATGATTCTAATGTACAGTGAAGG + Intergenic
974988109 4:69054425-69054447 GTGATTTTAATAAATACTAAAGG + Intronic
976209367 4:82651989-82652011 GTGATTCAAATGCACAGTAATGG - Intronic
976325952 4:83771861-83771883 GTGATTCTAATGCACAGCCAAGG - Intergenic
976942649 4:90724144-90724166 GTCATTCTATTGCTAACTAAAGG + Intronic
977082538 4:92550179-92550201 GTGATTATAATGAAGACTTATGG + Intronic
977151709 4:93520755-93520777 GTGATTCTGATTCACAATAAGGG + Intronic
977410080 4:96651690-96651712 ATGATCCTAATGTACACTGAAGG - Intergenic
978437560 4:108701858-108701880 GTGATTCTCATGCACACAGAAGG + Intergenic
979271732 4:118770099-118770121 GGGATTCTGATACACTCTAATGG + Intronic
979659428 4:123237026-123237048 GTGATTGTGATGCACAGTGAAGG + Intronic
980178587 4:129376500-129376522 GTGAATCTGATTCACACCAAAGG + Intergenic
981103253 4:140853773-140853795 GTGATTCTAATGCACCTTGAAGG - Intergenic
981166107 4:141559451-141559473 GTGATTCTGATGCATAGTAGGGG + Intergenic
982080788 4:151787507-151787529 GTGATTCTAATGTACAGCAAAGG - Intergenic
982105052 4:152004512-152004534 GTGATTCTAATGTGCAGCAAGGG - Intergenic
983344249 4:166506277-166506299 GTGATTCTCATTGACATTAATGG + Intergenic
987142758 5:14962285-14962307 CTGATTCTGATGTACACCAAAGG - Intergenic
990117803 5:52410701-52410723 ATGATTCTTATGCACACTAAAGG + Intergenic
990696746 5:58426624-58426646 GTGATGCTCAGGCACACAAAAGG - Intergenic
990733361 5:58833424-58833446 GTGATTCTAATGTACAGCCATGG + Intronic
991058788 5:62349190-62349212 GTAATTCTAATGTACAGTAAAGG - Intronic
991341238 5:65612476-65612498 GTGAGTCTATTGCACAATCACGG + Intronic
991430736 5:66542184-66542206 GTGATTCTAATGTGCAGTAGTGG - Intergenic
991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG + Intergenic
992100109 5:73398725-73398747 CTGATGCAAATGCACACTATGGG - Intergenic
992559701 5:77938688-77938710 GTGATTCTAATGCACAAATTTGG + Intergenic
992738484 5:79748239-79748261 ATGATTCTAATGCACAGCCAGGG + Intronic
993545422 5:89206493-89206515 GTGATTATAATGCAATATAAGGG + Intergenic
994058585 5:95447765-95447787 GTGATTCTAATGTACAACCAAGG - Intronic
995657164 5:114439611-114439633 GTGATTCTAATGCACCGCCAAGG + Intronic
996735727 5:126756365-126756387 CTGATTCTAAAGAACCCTAAGGG - Intergenic
997595647 5:135105564-135105586 GTGATTGTAATGCACAGCCATGG + Intronic
997793265 5:136782266-136782288 GTGATTCTAATGTGCAGGAAAGG - Intergenic
998518948 5:142782509-142782531 GTGATTCTAATGTGCAGCAAGGG + Intronic
998952931 5:147410367-147410389 GTGATTCTAATGCACTGTTCAGG + Intronic
999590171 5:153136469-153136491 GTGATTCTAAGGGACACTCCTGG - Intergenic
999995489 5:157088384-157088406 GTGATTCTAGTGAACAGTCAGGG - Intronic
1000371607 5:160541881-160541903 GTGATTCTCATGCACAATGGAGG + Intergenic
1001327402 5:170739100-170739122 GTGATTCCAATGCACACCTATGG + Intergenic
1002653719 5:180724645-180724667 CTGATTCTAATGCACACGTGTGG - Intergenic
1002826409 6:778008-778030 GTGATTCTAATGCACATCCCAGG - Intergenic
1002979535 6:2122339-2122361 GTGATTCTGATGCACACTAAAGG + Intronic
1003389831 6:5703997-5704019 ATGTTTCTAAAGCTCACTAAAGG - Intronic
1003422190 6:5968589-5968611 GTGATTCTAATGTGCAATGAAGG - Intergenic
1004635549 6:17464493-17464515 GTGATTCTACTGCACAAGCATGG - Intronic
1004762954 6:18690821-18690843 ATGATTCTAATGTACAGTCAGGG + Intergenic
1004850482 6:19693516-19693538 GTGATTCTAATGTACAATCAGGG + Intergenic
1005824754 6:29626103-29626125 GTGATTCTTATGTACACTGAAGG + Intronic
1006260262 6:32861977-32861999 GTGAAACTAATGGAAACTAATGG + Intergenic
1006754136 6:36399932-36399954 GTGAATCTAATGCACAGTCAGGG - Intronic
1007014529 6:38450846-38450868 GTGATTCTAATGTACACTCAAGG + Intronic
1007227292 6:40324174-40324196 GTGATTGTAATGCACAGTCAGGG + Intergenic
1007269071 6:40621873-40621895 GTGATTCTAATGCATAACTAGGG - Intergenic
1007990194 6:46247112-46247134 GTGATTCTGATGTACAGTAAAGG - Intronic
1008075928 6:47146328-47146350 GTGAGTCTGATGTCCACTAAAGG + Intergenic
1008128204 6:47691812-47691834 GTGATTCTAATGTACATTCAAGG + Intronic
1009027485 6:58017152-58017174 GTGATTCTAATGAACACTGAAGG + Intergenic
1009828291 6:68897034-68897056 GTCATGCTAAGGCACACTTAGGG + Intronic
1010444041 6:75931378-75931400 ACGATTCTGATGCACACTAAAGG - Intronic
1010470363 6:76219626-76219648 GTGAATCTAATGTAAACTATGGG + Intergenic
1011163486 6:84419327-84419349 GTGATTCCAATGCACAGTCAAGG + Intergenic
1011173853 6:84538292-84538314 GTGATTCTAATACACAAGTAAGG + Intergenic
1011329632 6:86189163-86189185 GTGATTCTAATGCATAGCCAAGG + Intergenic
1011663112 6:89610999-89611021 GTGATTCTAATGTGCACCCAAGG + Intronic
1011665784 6:89631735-89631757 GTGATTTTAAAGCAGATTAATGG + Intronic
1012238095 6:96841130-96841152 GTGATTCTAATGTGCAGTCAGGG - Intergenic
1013185101 6:107750666-107750688 GAGATTCTAATACACAGTTAAGG + Intronic
1013275187 6:108578261-108578283 GTGATTCTACTGCAAGCTGAGGG + Intronic
1013914516 6:115319467-115319489 ATGATTCTAATGCACAGCCAGGG - Intergenic
1014061407 6:117076072-117076094 AGGTTTTTAATGCACACTAATGG + Intergenic
1014732246 6:125046418-125046440 GTGATTCTAATATACAATCAGGG - Intronic
1015033569 6:128625739-128625761 GTGATTCCAATGCACTGTCAAGG - Intergenic
1016195513 6:141333060-141333082 GTGATTCTGATGCCCAGTGAAGG + Intergenic
1016499845 6:144707639-144707661 GTGATTCTGATTTACACTATAGG - Intronic
1016727431 6:147390749-147390771 GTGATTCGCGTACACACTAAAGG - Intergenic
1016845067 6:148561557-148561579 GTTATTCTGATGCATAGTAAGGG + Intergenic
1017631278 6:156398269-156398291 GTGATTCTGAGGCACAGTCATGG - Intergenic
1018010679 6:159667186-159667208 GTGATTCTAATACACATCTAGGG - Intergenic
1018723347 6:166590785-166590807 GTGAGTATAATCAACACTAACGG + Intronic
1020307090 7:6843705-6843727 GTGACTTTAATGAATACTAAAGG - Intergenic
1020311567 7:6872547-6872569 GTGACTTTAATGAATACTAAAGG - Intergenic
1020323123 7:6954887-6954909 GTGACTTTAATGAATACTAAAGG - Intergenic
1020482774 7:8682350-8682372 GTGTTTTAAAAGCACACTAAAGG + Intronic
1020823102 7:12994958-12994980 ATGATTGTAATGCACAGTCAAGG - Intergenic
1021362766 7:19736572-19736594 GTGATTCTAGTGTACAGTCAAGG + Intronic
1021856796 7:24864937-24864959 GTGATTCTAATGTGCAGTCAGGG + Intronic
1022405736 7:30088335-30088357 GTGATTCTAATGCACAAACAGGG - Intronic
1022433410 7:30352371-30352393 GTGATTCTAGTGCCCACTTCTGG + Intronic
1024151762 7:46578883-46578905 TTAATTCTAATGAAGACTAATGG - Intergenic
1024667971 7:51564829-51564851 GTGACTCAAATGGACACTAAAGG - Intergenic
1025802050 7:64795522-64795544 GTATTTCAAATGTACACTAAAGG - Intronic
1026433459 7:70371286-70371308 ATGATTCTGATGCACAGTGAGGG + Intronic
1026573834 7:71555310-71555332 TTGATTCTAAAGCACAATCAGGG - Intronic
1026897947 7:74021417-74021439 GTGATTCCAAGCCTCACTAATGG + Intergenic
1027361026 7:77410042-77410064 GTGATTCTAATGTACAGCCAGGG + Intronic
1028058120 7:86274299-86274321 GTCATTTTGATGAACACTAAGGG + Intergenic
1028072730 7:86472130-86472152 GTGATGCTGAATCACACTAAAGG + Intergenic
1028718508 7:94002585-94002607 GGGATTCTAATGTACAGTCAGGG + Intronic
1028879564 7:95864938-95864960 GTGATTCTGATGCCTGCTAAAGG - Intronic
1028968766 7:96832698-96832720 ATGATTCTAATGCAGTCTACAGG + Intergenic
1029078241 7:97952649-97952671 GTGACTTTAATGAATACTAAAGG - Intergenic
1030638752 7:111979999-111980021 GTGATTCTAATGGGCAATGAGGG + Intronic
1031848444 7:126833800-126833822 GTGGTTCTTAGGCACCCTAAAGG - Intronic
1032608635 7:133387129-133387151 CTGATTCTAATGCACACTCCTGG + Intronic
1033257711 7:139816528-139816550 GTGCTTCTAATGCACAGGTAGGG + Intronic
1036722505 8:11189834-11189856 GTGATTCTGATGCACAGCCAAGG + Intronic
1036816678 8:11907763-11907785 GTGACTTTAATGGATACTAAAGG - Intergenic
1036903562 8:12689709-12689731 GTGACTTTAATGAATACTAAAGG - Intergenic
1036906060 8:12709390-12709412 GTGACTTTAATGAATACTAAAGG - Intergenic
1037394874 8:18431047-18431069 GTGATTCAAACACACACTCATGG - Intergenic
1037794659 8:21982359-21982381 GTGATTGTCATGCATACTAATGG + Intronic
1038077446 8:24092022-24092044 GTGATTCTAATGTGCAGTAAGGG + Intergenic
1038799069 8:30732903-30732925 GTGACTTTAATGAATACTAAAGG + Intronic
1041620311 8:59960017-59960039 GTGATTCATATGCACATGAAAGG - Intergenic
1042117559 8:65448760-65448782 GTCCTTCTAATGTTCACTAAGGG + Intergenic
1042509251 8:69593966-69593988 GTGATTCTATAGGAAACTAAGGG + Intronic
1042624746 8:70745479-70745501 GAGATTCTGATGCACACTAAAGG - Intronic
1045330153 8:101148570-101148592 GTGATTTCAAAGCTCACTAATGG - Intergenic
1047159713 8:122364327-122364349 GTGATTTTAATGCACAGTTGAGG - Intergenic
1048016861 8:130505362-130505384 GTGATTCTCATGCACACTGTAGG - Intergenic
1048957427 8:139548614-139548636 GTGATTTTAATGAATACTAAAGG - Intergenic
1050286867 9:4112487-4112509 GTGATTCTAATGAGCAGTCAAGG - Intronic
1050646043 9:7720712-7720734 GAGATTATAATGCACACTGGAGG - Intergenic
1050648034 9:7743256-7743278 CTGATTCTAAGGCACAGTTAAGG - Intergenic
1051570343 9:18549945-18549967 GTGACTCGTATGCACATTAAAGG + Intronic
1052285435 9:26779385-26779407 GTCATTATAAAGCACAGTAAGGG - Intergenic
1052772762 9:32704675-32704697 GTGATTCTGATGCACAGCCAGGG - Intergenic
1053237646 9:36470093-36470115 GTGATGCTAATGCACATGAAGGG - Intronic
1054888002 9:70220048-70220070 GTGAATCTGATGCATGCTAAAGG + Intronic
1055051327 9:71984437-71984459 GTGATTCTAAAGTACACTTCTGG - Intronic
1056225504 9:84491062-84491084 GTGATTCTAAAGTACAGTCAAGG + Intergenic
1056367462 9:85919978-85920000 GTGATTCTAATCTACAGTCAAGG + Intergenic
1056865782 9:90226358-90226380 GTGACTTTAATGAATACTAAAGG + Intergenic
1056917234 9:90756544-90756566 GTGACTTTAATGAATACTAAAGG - Intergenic
1057431599 9:94999852-94999874 GAGATTCTAATGAAGGCTAATGG - Intronic
1059967705 9:119632154-119632176 GTAATTCTAATGCACAGTGAGGG - Intergenic
1060341235 9:122778827-122778849 CTGATTCCTATGCACCCTAAAGG + Intergenic
1062224224 9:135440290-135440312 GTGACTTTAATGAATACTAAAGG - Intergenic
1186289159 X:8077929-8077951 GTGATTCTAATGTTCCCCAAGGG - Intergenic
1186323805 X:8457464-8457486 GTGATTCTCATGTACAGTCATGG + Intergenic
1186818124 X:13258171-13258193 GTGACTCTAATGAACATTGAGGG + Intergenic
1186970179 X:14833635-14833657 GTGATTCTAATGTACAGCCAGGG - Intergenic
1187377694 X:18770982-18771004 GTGATTCTAATGTGCAGTCAAGG + Intronic
1187971150 X:24660007-24660029 GTGATTCTAATGCACAACCAAGG - Intronic
1188027445 X:25225422-25225444 GTTGTTCAAATTCACACTAAAGG - Intergenic
1188617111 X:32170838-32170860 GTGATTCTGCTGCACGCTGAGGG - Intronic
1188676446 X:32946799-32946821 GTGACTATAATGCACAGGAAAGG - Intronic
1188690819 X:33126500-33126522 GTGAATCTGATGCCCACTCAAGG + Intronic
1190367294 X:49708368-49708390 GTGATTCTGACGCATGCTAAAGG - Intergenic
1190845859 X:54189979-54190001 GTGATTCTAATATACAGTCAGGG + Intergenic
1191025816 X:55912030-55912052 GTAATTCTAATGTGCAGTAAAGG + Intergenic
1192400950 X:70835472-70835494 GTGAGTCTGATGCTCACAAAAGG - Intronic
1193971634 X:88062699-88062721 GAGATTCAAATGCACACCAAAGG - Intergenic
1194400495 X:93433986-93434008 GTGACTTTAATGAATACTAAAGG + Intergenic
1195156622 X:102129704-102129726 GTGATTCTGATTCATAATAAAGG + Intergenic
1195420461 X:104669680-104669702 GTGATTCTAATGTACAGCCAGGG + Intronic
1195889719 X:109679057-109679079 GTGATTCTGATACCCACTAGTGG - Intronic
1196738683 X:119004857-119004879 GTGATTCTGATGCACAGCAATGG + Intronic
1198110514 X:133498690-133498712 GTGATTCTAATGTGCAGTCAAGG + Intergenic
1199427680 X:147721922-147721944 GTGACTCTAATGTACACGCAAGG - Intergenic
1199429237 X:147740323-147740345 GTGATTCTAATGTGCATTCAAGG - Intergenic
1200275179 X:154725285-154725307 GTGATTCAGATGCATAATAAAGG - Intronic
1200925248 Y:8648507-8648529 GTGATTTTAATGAATACAAAAGG + Intergenic
1200948230 Y:8866942-8866964 GTGACTTTAATGAATACTAAAGG + Intergenic
1201446615 Y:14063666-14063688 ATGATTCTAATGTATACTCAGGG - Intergenic