ID: 1141839545

View in Genome Browser
Species Human (GRCh38)
Location 16:86566005-86566027
Sequence GTTTCGAAGCTGAAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141839543_1141839545 -4 Left 1141839543 16:86565986-86566008 CCTGGGAAAAGGGAGACGAGTTT No data
Right 1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141839545 Original CRISPR GTTTCGAAGCTGAAGTTGGT AGG Intergenic
No off target data available for this crispr