ID: 1141839755

View in Genome Browser
Species Human (GRCh38)
Location 16:86567130-86567152
Sequence GCAGGGGCGCGCGCTTTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141839755_1141839769 26 Left 1141839755 16:86567130-86567152 CCGCTGAAAGCGCGCGCCCCTGC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1141839769 16:86567179-86567201 CCCTCGCCCCGGAGGCTGCCAGG 0: 1
1: 0
2: 4
3: 37
4: 314
1141839755_1141839766 18 Left 1141839755 16:86567130-86567152 CCGCTGAAAGCGCGCGCCCCTGC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1141839766 16:86567171-86567193 CCCGCGCACCCTCGCCCCGGAGG 0: 1
1: 0
2: 0
3: 25
4: 157
1141839755_1141839764 15 Left 1141839755 16:86567130-86567152 CCGCTGAAAGCGCGCGCCCCTGC 0: 1
1: 0
2: 0
3: 0
4: 53
Right 1141839764 16:86567168-86567190 CCGCCCGCGCACCCTCGCCCCGG 0: 1
1: 0
2: 4
3: 31
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141839755 Original CRISPR GCAGGGGCGCGCGCTTTCAG CGG (reversed) Intergenic