ID: 1141839755 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:86567130-86567152 |
| Sequence | GCAGGGGCGCGCGCTTTCAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 54 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 53} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141839755_1141839769 | 26 | Left | 1141839755 | 16:86567130-86567152 | CCGCTGAAAGCGCGCGCCCCTGC | 0: 1 1: 0 2: 0 3: 0 4: 53 |
||
| Right | 1141839769 | 16:86567179-86567201 | CCCTCGCCCCGGAGGCTGCCAGG | 0: 1 1: 0 2: 4 3: 37 4: 314 |
||||
| 1141839755_1141839766 | 18 | Left | 1141839755 | 16:86567130-86567152 | CCGCTGAAAGCGCGCGCCCCTGC | 0: 1 1: 0 2: 0 3: 0 4: 53 |
||
| Right | 1141839766 | 16:86567171-86567193 | CCCGCGCACCCTCGCCCCGGAGG | 0: 1 1: 0 2: 0 3: 25 4: 157 |
||||
| 1141839755_1141839764 | 15 | Left | 1141839755 | 16:86567130-86567152 | CCGCTGAAAGCGCGCGCCCCTGC | 0: 1 1: 0 2: 0 3: 0 4: 53 |
||
| Right | 1141839764 | 16:86567168-86567190 | CCGCCCGCGCACCCTCGCCCCGG | 0: 1 1: 0 2: 4 3: 31 4: 310 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141839755 | Original CRISPR | GCAGGGGCGCGCGCTTTCAG CGG (reversed) | Intergenic | ||