ID: 1141840139

View in Genome Browser
Species Human (GRCh38)
Location 16:86568616-86568638
Sequence GGTGGTTCAGGTCCCCGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840139_1141840151 27 Left 1141840139 16:86568616-86568638 CCACAGCGGGGACCTGAACCACC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1141840151 16:86568666-86568688 AGCAAACTTTCCCCAACGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 91
1141840139_1141840152 28 Left 1141840139 16:86568616-86568638 CCACAGCGGGGACCTGAACCACC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1141840152 16:86568667-86568689 GCAAACTTTCCCCAACGTGCGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1141840139_1141840144 -2 Left 1141840139 16:86568616-86568638 CCACAGCGGGGACCTGAACCACC 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1141840144 16:86568637-86568659 CCTCCCCGGCCACACGTTCGCGG 0: 1
1: 0
2: 0
3: 12
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840139 Original CRISPR GGTGGTTCAGGTCCCCGCTG TGG (reversed) Exonic