ID: 1141840139 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:86568616-86568638 |
Sequence | GGTGGTTCAGGTCCCCGCTG TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 132 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 14, 4: 117} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141840139_1141840151 | 27 | Left | 1141840139 | 16:86568616-86568638 | CCACAGCGGGGACCTGAACCACC | 0: 1 1: 0 2: 0 3: 14 4: 117 |
||
Right | 1141840151 | 16:86568666-86568688 | AGCAAACTTTCCCCAACGTGCGG | 0: 1 1: 0 2: 0 3: 4 4: 91 |
||||
1141840139_1141840152 | 28 | Left | 1141840139 | 16:86568616-86568638 | CCACAGCGGGGACCTGAACCACC | 0: 1 1: 0 2: 0 3: 14 4: 117 |
||
Right | 1141840152 | 16:86568667-86568689 | GCAAACTTTCCCCAACGTGCGGG | 0: 1 1: 0 2: 0 3: 4 4: 47 |
||||
1141840139_1141840144 | -2 | Left | 1141840139 | 16:86568616-86568638 | CCACAGCGGGGACCTGAACCACC | 0: 1 1: 0 2: 0 3: 14 4: 117 |
||
Right | 1141840144 | 16:86568637-86568659 | CCTCCCCGGCCACACGTTCGCGG | 0: 1 1: 0 2: 0 3: 12 4: 65 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141840139 | Original CRISPR | GGTGGTTCAGGTCCCCGCTG TGG (reversed) | Exonic | ||