ID: 1141840647

View in Genome Browser
Species Human (GRCh38)
Location 16:86572158-86572180
Sequence AGGTCTCTGCCATGGTGTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840647_1141840657 19 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840657 16:86572200-86572222 CGTCCCTGGCGGGTTTTGGCTGG No data
1141840647_1141840654 8 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840654 16:86572189-86572211 ATTTAACGCTGCGTCCCTGGCGG No data
1141840647_1141840653 5 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840653 16:86572186-86572208 TTGATTTAACGCTGCGTCCCTGG No data
1141840647_1141840661 23 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840661 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
1141840647_1141840655 9 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840655 16:86572190-86572212 TTTAACGCTGCGTCCCTGGCGGG No data
1141840647_1141840658 20 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840647_1141840656 15 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840656 16:86572196-86572218 GCTGCGTCCCTGGCGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840647 Original CRISPR AGGTCTCTGCCATGGTGTTC GGG (reversed) Intergenic