ID: 1141840648

View in Genome Browser
Species Human (GRCh38)
Location 16:86572159-86572181
Sequence AAGGTCTCTGCCATGGTGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840648_1141840655 8 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840655 16:86572190-86572212 TTTAACGCTGCGTCCCTGGCGGG No data
1141840648_1141840653 4 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840653 16:86572186-86572208 TTGATTTAACGCTGCGTCCCTGG No data
1141840648_1141840657 18 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840657 16:86572200-86572222 CGTCCCTGGCGGGTTTTGGCTGG No data
1141840648_1141840656 14 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840656 16:86572196-86572218 GCTGCGTCCCTGGCGGGTTTTGG No data
1141840648_1141840661 22 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840661 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
1141840648_1141840658 19 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840648_1141840654 7 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840654 16:86572189-86572211 ATTTAACGCTGCGTCCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840648 Original CRISPR AAGGTCTCTGCCATGGTGTT CGG (reversed) Intergenic