ID: 1141840651

View in Genome Browser
Species Human (GRCh38)
Location 16:86572182-86572204
Sequence GGACGCAGCGTTAAATCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840651_1141840658 -4 Left 1141840651 16:86572182-86572204 CCCATTGATTTAACGCTGCGTCC No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840651_1141840656 -9 Left 1141840651 16:86572182-86572204 CCCATTGATTTAACGCTGCGTCC No data
Right 1141840656 16:86572196-86572218 GCTGCGTCCCTGGCGGGTTTTGG No data
1141840651_1141840662 23 Left 1141840651 16:86572182-86572204 CCCATTGATTTAACGCTGCGTCC No data
Right 1141840662 16:86572228-86572250 TTCTGACTCTAAGCACAGTCCGG No data
1141840651_1141840657 -5 Left 1141840651 16:86572182-86572204 CCCATTGATTTAACGCTGCGTCC No data
Right 1141840657 16:86572200-86572222 CGTCCCTGGCGGGTTTTGGCTGG No data
1141840651_1141840661 -1 Left 1141840651 16:86572182-86572204 CCCATTGATTTAACGCTGCGTCC No data
Right 1141840661 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840651 Original CRISPR GGACGCAGCGTTAAATCAAT GGG (reversed) Intergenic