ID: 1141840652

View in Genome Browser
Species Human (GRCh38)
Location 16:86572183-86572205
Sequence GGGACGCAGCGTTAAATCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840652_1141840658 -5 Left 1141840652 16:86572183-86572205 CCATTGATTTAACGCTGCGTCCC No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840652_1141840661 -2 Left 1141840652 16:86572183-86572205 CCATTGATTTAACGCTGCGTCCC No data
Right 1141840661 16:86572204-86572226 CCTGGCGGGTTTTGGCTGGGTGG No data
1141840652_1141840662 22 Left 1141840652 16:86572183-86572205 CCATTGATTTAACGCTGCGTCCC No data
Right 1141840662 16:86572228-86572250 TTCTGACTCTAAGCACAGTCCGG No data
1141840652_1141840657 -6 Left 1141840652 16:86572183-86572205 CCATTGATTTAACGCTGCGTCCC No data
Right 1141840657 16:86572200-86572222 CGTCCCTGGCGGGTTTTGGCTGG No data
1141840652_1141840656 -10 Left 1141840652 16:86572183-86572205 CCATTGATTTAACGCTGCGTCCC No data
Right 1141840656 16:86572196-86572218 GCTGCGTCCCTGGCGGGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840652 Original CRISPR GGGACGCAGCGTTAAATCAA TGG (reversed) Intergenic