ID: 1141840654

View in Genome Browser
Species Human (GRCh38)
Location 16:86572189-86572211
Sequence ATTTAACGCTGCGTCCCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840647_1141840654 8 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840654 16:86572189-86572211 ATTTAACGCTGCGTCCCTGGCGG No data
1141840648_1141840654 7 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840654 16:86572189-86572211 ATTTAACGCTGCGTCCCTGGCGG No data
1141840649_1141840654 0 Left 1141840649 16:86572166-86572188 CCATGGCAGAGACCTTCCCATTG No data
Right 1141840654 16:86572189-86572211 ATTTAACGCTGCGTCCCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840654 Original CRISPR ATTTAACGCTGCGTCCCTGG CGG Intergenic