ID: 1141840658

View in Genome Browser
Species Human (GRCh38)
Location 16:86572201-86572223
Sequence GTCCCTGGCGGGTTTTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141840649_1141840658 12 Left 1141840649 16:86572166-86572188 CCATGGCAGAGACCTTCCCATTG No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840652_1141840658 -5 Left 1141840652 16:86572183-86572205 CCATTGATTTAACGCTGCGTCCC No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840648_1141840658 19 Left 1141840648 16:86572159-86572181 CCGAACACCATGGCAGAGACCTT No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840647_1141840658 20 Left 1141840647 16:86572158-86572180 CCCGAACACCATGGCAGAGACCT No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840651_1141840658 -4 Left 1141840651 16:86572182-86572204 CCCATTGATTTAACGCTGCGTCC No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data
1141840650_1141840658 0 Left 1141840650 16:86572178-86572200 CCTTCCCATTGATTTAACGCTGC No data
Right 1141840658 16:86572201-86572223 GTCCCTGGCGGGTTTTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141840658 Original CRISPR GTCCCTGGCGGGTTTTGGCT GGG Intergenic
No off target data available for this crispr